Incidental Mutation 'R3811:Txndc5'
ID275206
Institutional Source Beutler Lab
Gene Symbol Txndc5
Ensembl Gene ENSMUSG00000038991
Gene Namethioredoxin domain containing 5
SynonymsPC-TRP, ERp46
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38500079-38528824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38523405 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 99 (K99E)
Ref Sequence ENSEMBL: ENSMUSP00000041839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035988] [ENSMUST00000160653] [ENSMUST00000162075]
Predicted Effect probably benign
Transcript: ENSMUST00000035988
AA Change: K99E

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041839
Gene: ENSMUSG00000038991
AA Change: K99E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Thioredoxin 49 153 5.3e-28 PFAM
low complexity region 156 172 N/A INTRINSIC
Pfam:Thioredoxin 176 279 2.8e-30 PFAM
Pfam:Thioredoxin 308 412 6.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160653
AA Change: K26E

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124401
Gene: ENSMUSG00000038991
AA Change: K26E

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 80 6.3e-22 PFAM
low complexity region 83 99 N/A INTRINSIC
Pfam:Thioredoxin 103 206 4.2e-31 PFAM
Pfam:Thioredoxin 235 339 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162075
AA Change: K5E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124516
Gene: ENSMUSG00000038991
AA Change: K5E

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 59 1.5e-13 PFAM
low complexity region 62 78 N/A INTRINSIC
Pfam:Thioredoxin 82 185 5e-31 PFAM
Pfam:Thioredoxin 214 318 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224471
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal endoplasmic reticulum (ER)-signal sequence, three catalytically active thioredoxin domains and a C-terminal ER-retention sequence. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S5 gene. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Other mutations in Txndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0164:Txndc5 UTSW 13 38507953 missense probably damaging 1.00
R0164:Txndc5 UTSW 13 38507953 missense probably damaging 1.00
R0691:Txndc5 UTSW 13 38507896 missense probably damaging 1.00
R0741:Txndc5 UTSW 13 38528260 missense possibly damaging 0.94
R3810:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R3812:Txndc5 UTSW 13 38523405 missense probably benign 0.30
R5009:Txndc5 UTSW 13 38528184 unclassified probably null
R5472:Txndc5 UTSW 13 38513125 missense possibly damaging 0.65
R6089:Txndc5 UTSW 13 38523416 start codon destroyed probably null 0.70
R6292:Txndc5 UTSW 13 38528184 unclassified probably null
R6443:Txndc5 UTSW 13 38528203 missense possibly damaging 0.56
X0067:Txndc5 UTSW 13 38523387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATTCAGCGCCTGGGATC -3'
(R):5'- AGAACAGTGTCGTTGTGAGGTATC -3'

Sequencing Primer
(F):5'- CCTGGGATCTAGGAAGGAAGTTACC -3'
(R):5'- AGGTATCTGTCTGCTGCAGAG -3'
Posted On2015-04-02