Incidental Mutation 'R3811:Cyth4'
ID275207
Institutional Source Beutler Lab
Gene Symbol Cyth4
Ensembl Gene ENSMUSG00000018008
Gene Namecytohesin 4
Synonyms5830469K17Rik, 2510004M07Rik, Pscd4
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78597047-78622019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78604649 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 39 (E39G)
Ref Sequence ENSEMBL: ENSMUSP00000154995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043069] [ENSMUST00000229248] [ENSMUST00000229256] [ENSMUST00000229295] [ENSMUST00000229717] [ENSMUST00000229796] [ENSMUST00000231168] [ENSMUST00000231180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043069
AA Change: E39G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042698
Gene: ENSMUSG00000018008
AA Change: E39G

DomainStartEndE-ValueType
Sec7 58 243 1.05e-90 SMART
PH 260 377 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229233
Predicted Effect probably damaging
Transcript: ENSMUST00000229248
AA Change: E39G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229256
Predicted Effect probably damaging
Transcript: ENSMUST00000229295
AA Change: E36G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229717
Predicted Effect probably damaging
Transcript: ENSMUST00000229796
AA Change: E36G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230705
Predicted Effect probably damaging
Transcript: ENSMUST00000231168
AA Change: E39G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231176
Predicted Effect probably damaging
Transcript: ENSMUST00000231180
AA Change: E39G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD family of proteins, which have an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family function as GEPs for ADP-ribosylation factors (ARFs), which are guanine nucleotide-binding proteins involved in vesicular trafficking pathways. This protein exhibits GEP activity in vitro with ARF1 and ARF5, but is inactive with ARF6. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Spem2 T C 11: 69,817,164 E325G possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Cyth4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Cyth4 APN 15 78619913 missense probably benign 0.00
R0522:Cyth4 UTSW 15 78615785 missense possibly damaging 0.67
R0584:Cyth4 UTSW 15 78609878 splice site probably null
R2018:Cyth4 UTSW 15 78608171 missense probably damaging 1.00
R3804:Cyth4 UTSW 15 78609802 missense probably damaging 1.00
R4728:Cyth4 UTSW 15 78602713 missense probably benign 0.01
R4738:Cyth4 UTSW 15 78605874 missense probably benign 0.02
R5392:Cyth4 UTSW 15 78606985 missense probably damaging 1.00
R5594:Cyth4 UTSW 15 78607075 unclassified probably null
R6414:Cyth4 UTSW 15 78608146 missense probably damaging 0.97
R7241:Cyth4 UTSW 15 78607045 missense probably benign 0.38
R7472:Cyth4 UTSW 15 78605894 missense probably damaging 1.00
R8253:Cyth4 UTSW 15 78602737 missense probably benign 0.09
Z1177:Cyth4 UTSW 15 78619919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCTGGTACATGCACAAG -3'
(R):5'- AGCCTCTGACCGGTAATGTG -3'

Sequencing Primer
(F):5'- TGGTACATGCACAAGAGCCAAAC -3'
(R):5'- TCTGACCGGTAATGTGCAGGC -3'
Posted On2015-04-02