Mutagenetix > Incidental Mutation

Incidental Mutation 'R3811:Tsc2'

275210

Institutional Source

Beutler Lab

Gene Symbol

Tsc2

Ensembl Gene

ENSMUSG00000002496

Gene Name

tuberous sclerosis 2

Synonyms

tuberin, Nafld

MMRRC Submission

040767-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3811 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24595816-24632630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24629037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 70 (D70G)

Ref Sequence

ENSEMBL: ENSMUSP00000153758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047611] [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227509] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000047611

SMART Domains

Protein: ENSMUSP00000047413
Gene: ENSMUSG00000041429

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
low complexity region	24	37	N/A	INTRINSIC
low complexity region	55	68	N/A	INTRINSIC
ENDO3c	126	276	1.06e-58	SMART
FES	277	297	4.82e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097373
AA Change: D129G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: D129G

Domain	Start	End	E-Value	Type
Pfam:DUF3384	54	470	4e-103	PFAM
Pfam:Tuberin	555	903	5.9e-149	PFAM
low complexity region	1023	1054	N/A	INTRINSIC
low complexity region	1271	1278	N/A	INTRINSIC
low complexity region	1310	1328	N/A	INTRINSIC
low complexity region	1330	1344	N/A	INTRINSIC
low complexity region	1378	1398	N/A	INTRINSIC
Pfam:Rap_GAP	1497	1685	1.3e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226284
AA Change: D129G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000226398
AA Change: D129G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000227509

Predicted Effect

probably benign
Transcript: ENSMUST00000227607
AA Change: D70G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000227745
AA Change: D129G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227754

Predicted Effect

probably benign
Transcript: ENSMUST00000228412
AA Change: D129G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

Meta Mutation Damage Score

0.0851

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl3	G	T	6: 34,799,729	S385I	probably damaging	Het
Arhgap28	G	A	17: 67,896,093	P122S	probably benign	Het
Arid2	T	C	15: 96,289,086	V73A	probably benign	Het
Atp1b1	C	T	1: 164,443,305	R35H	probably benign	Het
Cacybp	T	C	1: 160,203,652	D202G	probably benign	Het
Chsy3	C	G	18: 59,176,170	P165R	probably benign	Het
Creb3	C	T	4: 43,565,501	Q227*	probably null	Het
Crnkl1	C	A	2: 145,931,306	R140L	probably damaging	Het
Cyth4	A	G	15: 78,604,649	E39G	probably damaging	Het
Dnah6	T	C	6: 73,191,498	T481A	probably benign	Het
Dock4	T	A	12: 40,779,124	I1003N	possibly damaging	Het
Galntl5	T	C	5: 25,186,180	F26L	probably benign	Het
Glrx5	C	G	12: 105,032,888	C63W	probably damaging	Het
Gm9602	T	A	14: 4,776,499	I28N	probably damaging	Het
Hivep2	A	G	10: 14,130,357	T900A	probably benign	Het
Hmcn1	A	G	1: 150,649,577		probably null	Het
Ighv1-24	G	T	12: 114,773,065	L72I	probably benign	Het
Ilvbl	G	A	10: 78,579,035	C244Y	probably benign	Het
Kat7	A	G	11: 95,291,615		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Lamc1	A	T	1: 153,262,708		probably null	Het
Mall	T	A	2: 127,708,854	I129F	probably damaging	Het
Mdn1	A	T	4: 32,693,506	K1044*	probably null	Het
Med23	A	T	10: 24,892,592	R77*	probably null	Het
Med23	G	A	10: 24,892,593		probably null	Het
Metap2	A	T	10: 93,870,164	L252*	probably null	Het
Olfr1066	A	T	2: 86,455,347	V308E	probably benign	Het
Psmd1	T	A	1: 86,132,715	V828D	probably damaging	Het
Psmd9	C	T	5: 123,234,590		probably benign	Het
Rbbp5	T	C	1: 132,492,587	V59A	probably damaging	Het
Sco2	T	C	15: 89,373,679		probably benign	Het
Slc32a1	G	T	2: 158,614,736	C437F	possibly damaging	Het
Spem2	T	C	11: 69,817,164	E325G	possibly damaging	Het
Steap4	A	G	5: 7,977,017	T327A	probably benign	Het
Txndc5	T	C	13: 38,523,405	K99E	probably benign	Het

Other mutations in Tsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Tsc2	APN	17	24608107	missense	probably damaging	1.00
IGL00985:Tsc2	APN	17	24597131	missense	probably damaging	1.00
IGL01386:Tsc2	APN	17	24613285	missense	probably damaging	1.00
IGL01468:Tsc2	APN	17	24621097	missense	possibly damaging	0.90
IGL01530:Tsc2	APN	17	24622662	missense	possibly damaging	0.76
IGL02390:Tsc2	APN	17	24600453	missense	probably damaging	1.00
IGL02398:Tsc2	APN	17	24621729	missense	probably damaging	1.00
IGL02741:Tsc2	APN	17	24629969	missense	probably damaging	1.00
IGL03191:Tsc2	APN	17	24628054	missense	probably damaging	1.00
IGL03372:Tsc2	APN	17	24619470	missense	probably damaging	1.00
IGL03412:Tsc2	APN	17	24597068	missense	probably damaging	0.98
Twitch	UTSW	17	24596742	splice site	probably null
PIT4515001:Tsc2	UTSW	17	24621147	missense	probably benign	0.15
R0025:Tsc2	UTSW	17	24631004	splice site	probably benign
R0025:Tsc2	UTSW	17	24631004	splice site	probably benign
R0138:Tsc2	UTSW	17	24599626	missense	possibly damaging	0.65
R0540:Tsc2	UTSW	17	24621712	missense	probably damaging	1.00
R0570:Tsc2	UTSW	17	24626727	missense	probably damaging	1.00
R0607:Tsc2	UTSW	17	24621712	missense	probably damaging	1.00
R0826:Tsc2	UTSW	17	24596958	missense	probably benign	0.04
R1430:Tsc2	UTSW	17	24599023	critical splice donor site	probably null
R1440:Tsc2	UTSW	17	24614392	missense	probably damaging	1.00
R1466:Tsc2	UTSW	17	24608973	missense	probably damaging	1.00
R1466:Tsc2	UTSW	17	24608973	missense	probably damaging	1.00
R1541:Tsc2	UTSW	17	24631976	missense	probably damaging	1.00
R1717:Tsc2	UTSW	17	24597068	missense	probably damaging	0.98
R1799:Tsc2	UTSW	17	24604408	missense	probably benign
R2030:Tsc2	UTSW	17	24623470	splice site	probably benign
R2147:Tsc2	UTSW	17	24621142	missense	possibly damaging	0.62
R2888:Tsc2	UTSW	17	24631995	critical splice donor site	probably null
R3609:Tsc2	UTSW	17	24622550	missense	possibly damaging	0.74
R3610:Tsc2	UTSW	17	24622550	missense	possibly damaging	0.74
R3895:Tsc2	UTSW	17	24599812	missense	probably damaging	1.00
R3962:Tsc2	UTSW	17	24621166	splice site	probably benign
R3971:Tsc2	UTSW	17	24623588	missense	probably damaging	1.00
R4018:Tsc2	UTSW	17	24625281	missense	probably damaging	0.99
R4184:Tsc2	UTSW	17	24632016	missense	probably benign	0.43
R4435:Tsc2	UTSW	17	24599713	missense	probably benign	0.01
R4437:Tsc2	UTSW	17	24599713	missense	probably benign	0.01
R4474:Tsc2	UTSW	17	24597264	missense	probably damaging	0.98
R4703:Tsc2	UTSW	17	24604909	missense	probably benign	0.13
R4731:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4732:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4733:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4817:Tsc2	UTSW	17	24596742	splice site	probably null
R4890:Tsc2	UTSW	17	24600035	missense	probably damaging	1.00
R4922:Tsc2	UTSW	17	24600369	missense	probably benign	0.22
R5119:Tsc2	UTSW	17	24603280	missense	probably benign	0.00
R5393:Tsc2	UTSW	17	24600396	missense	possibly damaging	0.89
R5785:Tsc2	UTSW	17	24599887	splice site	probably null
R5838:Tsc2	UTSW	17	24613216	missense	probably benign	0.01
R5857:Tsc2	UTSW	17	24600007	missense	probably damaging	0.99
R5911:Tsc2	UTSW	17	24600387	missense	possibly damaging	0.63
R5988:Tsc2	UTSW	17	24620766	missense	probably damaging	1.00
R6275:Tsc2	UTSW	17	24600420	missense	probably benign	0.00
R6290:Tsc2	UTSW	17	24596910	missense	probably benign	0.04
R6371:Tsc2	UTSW	17	24626714	missense	probably benign	0.00
R6467:Tsc2	UTSW	17	24609127	missense	probably benign	0.04
R6577:Tsc2	UTSW	17	24610499	missense	probably damaging	1.00
R6728:Tsc2	UTSW	17	24621124	missense	probably damaging	1.00
R6918:Tsc2	UTSW	17	24613229	missense	probably damaging	1.00
R6995:Tsc2	UTSW	17	24628054	missense	probably damaging	1.00
R7026:Tsc2	UTSW	17	24626739	missense	probably damaging	0.99
R7136:Tsc2	UTSW	17	24613280	missense	probably benign	0.00
R7236:Tsc2	UTSW	17	24623594	missense	possibly damaging	0.82
R7243:Tsc2	UTSW	17	24599630	missense	probably benign	0.02
R7249:Tsc2	UTSW	17	24607755	missense	probably damaging	1.00
R7450:Tsc2	UTSW	17	24600031	missense	probably damaging	1.00
R7522:Tsc2	UTSW	17	24630965	missense	probably damaging	1.00
R7529:Tsc2	UTSW	17	24597948	missense	probably damaging	0.98
R7637:Tsc2	UTSW	17	24607492	missense	probably benign	0.13
R7781:Tsc2	UTSW	17	24608115	missense	possibly damaging	0.52
R8005:Tsc2	UTSW	17	24599596	missense	probably damaging	0.98
R8262:Tsc2	UTSW	17	24614366	missense	probably benign	0.06
R8268:Tsc2	UTSW	17	24600010	missense	probably benign	0.44
R8400:Tsc2	UTSW	17	24604987	missense	possibly damaging	0.62
R9020:Tsc2	UTSW	17	24626717	missense	probably damaging	0.99
R9039:Tsc2	UTSW	17	24607515	missense	probably benign	0.01
R9065:Tsc2	UTSW	17	24603190	missense	probably benign	0.39
R9123:Tsc2	UTSW	17	24604828	missense	probably null	0.40
R9125:Tsc2	UTSW	17	24604828	missense	probably null	0.40
R9186:Tsc2	UTSW	17	24604888	missense	probably damaging	1.00
R9390:Tsc2	UTSW	17	24604850	missense	probably damaging	1.00
R9542:Tsc2	UTSW	17	24600334	critical splice donor site	probably null
R9721:Tsc2	UTSW	17	24599642	nonsense	probably null
Z1177:Tsc2	UTSW	17	24620779	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- CACTGATAAGCTCCCAAGGC -3'
(R):5'- GTGATATTGCTAACCTGCCTTC -3'

Sequencing Primer
(F):5'- CAAATGGTAAATGGCCCTGTGC -3'
(R):5'- GATATTGCTAACCTGCCTTCCATAAG -3'

Posted On

2015-04-02