Incidental Mutation 'R3822:Man1a2'
ID275219
Institutional Source Beutler Lab
Gene Symbol Man1a2
Ensembl Gene ENSMUSG00000008763
Gene Namemannosidase, alpha, class 1A, member 2
SynonymsMan1b
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3822 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100562208-100685503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100632597 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 176 (I176T)
Ref Sequence ENSEMBL: ENSMUSP00000116489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008907] [ENSMUST00000130066]
Predicted Effect probably benign
Transcript: ENSMUST00000008907
AA Change: I286T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000008907
Gene: ENSMUSG00000008763
AA Change: I286T

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
coiled coil region 101 153 N/A INTRINSIC
low complexity region 155 170 N/A INTRINSIC
Pfam:Glyco_hydro_47 187 626 2.8e-156 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130066
AA Change: I176T

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116489
Gene: ENSMUSG00000008763
AA Change: I176T

DomainStartEndE-ValueType
coiled coil region 18 70 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
Pfam:Glyco_hydro_47 104 179 1.2e-23 PFAM
Pfam:Glyco_hydro_47 174 246 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200265
Meta Mutation Damage Score 0.1677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress and death within a few hours after birth. Lung development is delayed, the alveolar septum is thickened, and hemorrhage occurs in the alveolar region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Man1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Man1a2 APN 3 100644557 missense probably damaging 1.00
IGL02009:Man1a2 APN 3 100684662 missense probably damaging 0.99
IGL02097:Man1a2 APN 3 100582131 missense possibly damaging 0.68
IGL02395:Man1a2 APN 3 100644537 splice site probably null
IGL02441:Man1a2 APN 3 100591873 missense probably benign 0.01
R0043:Man1a2 UTSW 3 100587880 missense probably damaging 1.00
R0064:Man1a2 UTSW 3 100591883 missense possibly damaging 0.95
R0217:Man1a2 UTSW 3 100617037 missense possibly damaging 0.61
R0266:Man1a2 UTSW 3 100582034 missense probably damaging 1.00
R0284:Man1a2 UTSW 3 100684786 missense probably damaging 0.98
R0633:Man1a2 UTSW 3 100684575 missense possibly damaging 0.80
R1074:Man1a2 UTSW 3 100656086 missense possibly damaging 0.68
R2167:Man1a2 UTSW 3 100591900 missense probably damaging 1.00
R2177:Man1a2 UTSW 3 100632531 missense probably damaging 1.00
R4361:Man1a2 UTSW 3 100656042 missense probably benign
R4652:Man1a2 UTSW 3 100632561 missense probably damaging 1.00
R4871:Man1a2 UTSW 3 100617056 missense probably damaging 1.00
R5153:Man1a2 UTSW 3 100656263 missense probably damaging 1.00
R5182:Man1a2 UTSW 3 100647017 missense probably damaging 0.99
R5201:Man1a2 UTSW 3 100617012 missense probably benign
R5251:Man1a2 UTSW 3 100620099 missense probably damaging 1.00
R6135:Man1a2 UTSW 3 100684932 start gained probably benign
R6793:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R6886:Man1a2 UTSW 3 100656071 missense probably benign 0.00
R7209:Man1a2 UTSW 3 100647079 missense unknown
R7224:Man1a2 UTSW 3 100582053 missense possibly damaging 0.85
R7308:Man1a2 UTSW 3 100620105 missense probably damaging 1.00
R7815:Man1a2 UTSW 3 100656179 missense probably damaging 0.99
R7826:Man1a2 UTSW 3 100582139 missense probably damaging 1.00
R8427:Man1a2 UTSW 3 100684685 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GTGGAATAGCTAATTGGAAATCTCC -3'
(R):5'- AGATGATGACCAGAACTATGCCC -3'

Sequencing Primer
(F):5'- GGAAATCTCCATGAACAAAAATGTC -3'
(R):5'- TGTCCACTGAGGCTGTCACATG -3'
Posted On2015-04-02