Incidental Mutation 'R3822:Cth'
ID 275221
Institutional Source Beutler Lab
Gene Symbol Cth
Ensembl Gene ENSMUSG00000028179
Gene Name cystathionase (cystathionine gamma-lyase)
Synonyms CSE, 0610010I13Rik
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3822 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 157894248-157925077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 157918499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 127 (F127S)
Ref Sequence ENSEMBL: ENSMUSP00000113672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118539]
AlphaFold Q8VCN5
Predicted Effect probably benign
Transcript: ENSMUST00000118539
AA Change: F127S

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113672
Gene: ENSMUSG00000028179
AA Change: F127S

DomainStartEndE-ValueType
Pfam:Cys_Met_Meta_PP 18 394 5.8e-157 PFAM
Pfam:Aminotran_1_2 32 235 4.3e-9 PFAM
Pfam:DegT_DnrJ_EryC1 53 246 1.9e-7 PFAM
Pfam:Aminotran_5 68 232 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125028
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit hypertension associated with impaired endothelium-dependent vasorelaxation. Mice homozygous for another knock-out allele exhibit normal blood pressure but sensitivty to a low cysteine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Cth
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cth APN 3 157905167 missense probably damaging 0.99
IGL01744:Cth APN 3 157924935 missense probably benign
IGL03128:Cth APN 3 157921035 missense probably damaging 1.00
R0477:Cth UTSW 3 157905175 missense probably damaging 1.00
R0659:Cth UTSW 3 157920115 splice site probably benign
R1699:Cth UTSW 3 157907436 missense probably damaging 1.00
R1724:Cth UTSW 3 157913727 missense probably damaging 1.00
R1744:Cth UTSW 3 157906268 missense probably damaging 0.99
R3937:Cth UTSW 3 157920040 missense possibly damaging 0.79
R3982:Cth UTSW 3 157913697 nonsense probably null
R4342:Cth UTSW 3 157924976 missense probably damaging 1.00
R5436:Cth UTSW 3 157894826 missense probably benign
R7466:Cth UTSW 3 157924885 missense probably benign 0.05
R8348:Cth UTSW 3 157925020 missense probably benign 0.19
R8448:Cth UTSW 3 157925020 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCATTGAGATTCTAGCCCATG -3'
(R):5'- CATGTTGCTTAGCTACACTGAAG -3'

Sequencing Primer
(F):5'- TGAGATTCTAGCCCATGTCAAACTC -3'
(R):5'- GCAGATACTTCCTGACCT -3'
Posted On 2015-04-02