Incidental Mutation 'R3822:Neto2'
ID 275227
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R3822 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 85636588-85700924 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 85663295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 180 (E180*)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably null
Transcript: ENSMUST00000109686
AA Change: E208*
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: E208*

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably null
Transcript: ENSMUST00000209479
AA Change: E173*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably null
Transcript: ENSMUST00000216286
AA Change: E180*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3940:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4433:Neto2 UTSW 8 85641083 missense probably damaging 1.00
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R5571:Neto2 UTSW 8 85640544 missense probably damaging 1.00
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6381:Neto2 UTSW 8 85642509 missense probably damaging 0.99
R6572:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6881:Neto2 UTSW 8 85640556 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
R7754:Neto2 UTSW 8 85669700 missense probably damaging 0.98
R7755:Neto2 UTSW 8 85669656 missense probably damaging 1.00
R8682:Neto2 UTSW 8 85640666 missense probably benign 0.01
R9326:Neto2 UTSW 8 85642434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAGGTGCCCAATACAGTAAAG -3'
(R):5'- AGCTCAGTACCAATGACTTTCTCC -3'

Sequencing Primer
(F):5'- GTGCCCAATACAGTAAAGGAAAC -3'
(R):5'- CTCTCTTTTGTTACAGATCCAGAC -3'
Posted On 2015-04-02