Incidental Mutation 'R3822:Mns1'
ID275229
Institutional Source Beutler Lab
Gene Symbol Mns1
Ensembl Gene ENSMUSG00000032221
Gene Namemeiosis-specific nuclear structural protein 1
Synonyms
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3822 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72438011-72462025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72439448 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 71 (E71G)
Ref Sequence ENSEMBL: ENSMUSP00000139105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034746] [ENSMUST00000183809] [ENSMUST00000184604]
Predicted Effect probably damaging
Transcript: ENSMUST00000034746
AA Change: E71G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034746
Gene: ENSMUSG00000032221
AA Change: E71G

DomainStartEndE-ValueType
Pfam:TPH 117 462 3.1e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183809
AA Change: E71G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139105
Gene: ENSMUSG00000032221
AA Change: E71G

DomainStartEndE-ValueType
Pfam:Trichoplein 116 219 5.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184604
AA Change: E71G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139232
Gene: ENSMUSG00000032221
AA Change: E71G

DomainStartEndE-ValueType
Pfam:Trichoplein 116 158 8e-12 PFAM
Pfam:Trichoplein 150 206 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194708
Meta Mutation Damage Score 0.1183 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, male infertility, sperm flagellum abnormalities, immotile sperm, randomized left-right patterning, hydroencephaly, and motile cilia abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Mns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Mns1 APN 9 72456913 unclassified probably benign
R0390:Mns1 UTSW 9 72452804 missense probably damaging 1.00
R0512:Mns1 UTSW 9 72449471 missense possibly damaging 0.87
R1803:Mns1 UTSW 9 72452734 missense probably damaging 1.00
R1988:Mns1 UTSW 9 72448759 unclassified probably null
R3821:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R4640:Mns1 UTSW 9 72439282 missense probably benign 0.36
R6051:Mns1 UTSW 9 72449453 missense probably damaging 1.00
R6696:Mns1 UTSW 9 72452762 missense probably damaging 1.00
R6835:Mns1 UTSW 9 72452744 missense probably damaging 1.00
R7257:Mns1 UTSW 9 72452815 missense probably damaging 1.00
R7340:Mns1 UTSW 9 72448743 missense probably damaging 1.00
R7903:Mns1 UTSW 9 72452811 missense probably benign 0.04
R7986:Mns1 UTSW 9 72452811 missense probably benign 0.04
R8068:Mns1 UTSW 9 72448527 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCAAAGACCTTTTATACTGTTACC -3'
(R):5'- GCATGCAAACTGACCAACTG -3'

Sequencing Primer
(F):5'- CGCACTTGTAGGCGACCAAAAAG -3'
(R):5'- ACTGACACCACGTTCTTCAG -3'
Posted On2015-04-02