Incidental Mutation 'R3822:Ccdc13'
ID275232
Institutional Source Beutler Lab
Gene Symbol Ccdc13
Ensembl Gene ENSMUSG00000079235
Gene Namecoiled-coil domain containing 13
Synonyms
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3822 (G1)
Quality Score211
Status Validated
Chromosome9
Chromosomal Location121797627-121839461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121831019 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 76 (L76F)
Ref Sequence ENSEMBL: ENSMUSP00000114787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135986]
Predicted Effect probably damaging
Transcript: ENSMUST00000135986
AA Change: L76F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114787
Gene: ENSMUSG00000079235
AA Change: L76F

DomainStartEndE-ValueType
coiled coil region 19 46 N/A INTRINSIC
coiled coil region 70 103 N/A INTRINSIC
coiled coil region 139 178 N/A INTRINSIC
coiled coil region 206 248 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
coiled coil region 323 370 N/A INTRINSIC
coiled coil region 428 458 N/A INTRINSIC
coiled coil region 550 604 N/A INTRINSIC
coiled coil region 648 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152043
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Ccdc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Ccdc13 APN 9 121810084 splice site probably benign
IGL01306:Ccdc13 APN 9 121827363 missense probably benign 0.37
ANU23:Ccdc13 UTSW 9 121827363 missense probably benign 0.37
R0112:Ccdc13 UTSW 9 121813481 missense probably damaging 0.98
R0144:Ccdc13 UTSW 9 121827351 missense probably damaging 0.98
R0360:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R0364:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R1441:Ccdc13 UTSW 9 121813449 missense probably benign 0.44
R1674:Ccdc13 UTSW 9 121809142 missense probably damaging 1.00
R1691:Ccdc13 UTSW 9 121825068 splice site probably null
R1710:Ccdc13 UTSW 9 121819581 missense probably damaging 1.00
R3821:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3962:Ccdc13 UTSW 9 121798939 intron probably benign
R4695:Ccdc13 UTSW 9 121820760 missense probably damaging 1.00
R4758:Ccdc13 UTSW 9 121833734 missense possibly damaging 0.91
R5058:Ccdc13 UTSW 9 121817547 intron probably benign
R5283:Ccdc13 UTSW 9 121808188 missense probably damaging 1.00
R5436:Ccdc13 UTSW 9 121799043 missense probably benign 0.06
R5601:Ccdc13 UTSW 9 121800572 nonsense probably null
R5623:Ccdc13 UTSW 9 121833733 missense probably damaging 0.99
R5653:Ccdc13 UTSW 9 121798787 makesense probably null
R5665:Ccdc13 UTSW 9 121814290 missense probably damaging 0.99
R5975:Ccdc13 UTSW 9 121827235 missense probably benign 0.00
R6212:Ccdc13 UTSW 9 121798909 intron probably benign
R6213:Ccdc13 UTSW 9 121798909 intron probably benign
R6214:Ccdc13 UTSW 9 121798909 intron probably benign
R6215:Ccdc13 UTSW 9 121798909 intron probably benign
R6222:Ccdc13 UTSW 9 121798909 intron probably benign
R6223:Ccdc13 UTSW 9 121798909 intron probably benign
R6257:Ccdc13 UTSW 9 121798909 intron probably benign
R7053:Ccdc13 UTSW 9 121833838 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACTGTGAGCACACCTGACC -3'
(R):5'- ACCCAGCTCTGAGAACAGTATG -3'

Sequencing Primer
(F):5'- ACCTGACCCGGCACTGTTC -3'
(R):5'- AGCTCTGAGAACAGTATGTTTAAATC -3'
Posted On2015-04-02