Incidental Mutation 'R3822:Cnot6'
ID275236
Institutional Source Beutler Lab
Gene Symbol Cnot6
Ensembl Gene ENSMUSG00000020362
Gene NameCCR4-NOT transcription complex, subunit 6
SynonymsA230103N10Rik
MMRRC Submission 040884-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R3822 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49671503-49712723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49689172 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 98 (S98T)
Ref Sequence ENSEMBL: ENSMUSP00000121239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020624] [ENSMUST00000145353]
Predicted Effect probably benign
Transcript: ENSMUST00000020624
AA Change: S98T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020624
Gene: ENSMUSG00000020362
AA Change: S98T

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 187 526 1.9e-23 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109183
Predicted Effect probably benign
Transcript: ENSMUST00000145353
AA Change: S98T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121239
Gene: ENSMUSG00000020362
AA Change: S98T

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 192 531 1.9e-23 PFAM
low complexity region 534 547 N/A INTRINSIC
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic component of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substrates. The CCR4-NOT complex plays a role in many cellular processes, including miRNA-mediated repression, mRNA degradation, and transcriptional regulation. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Chka A G 19: 3,882,038 probably benign Het
Cth A G 3: 157,918,499 F127S probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Dysf T C 6: 84,207,088 probably benign Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Gpr89 A G 3: 96,892,944 S113P probably benign Het
Herpud2 G A 9: 25,124,924 Q147* probably null Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Hlcs T C 16: 94,267,981 N274D probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Man1a2 A G 3: 100,632,597 I176T possibly damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Psmb7 A T 2: 38,613,428 probably benign Het
Rin2 C T 2: 145,822,630 T60M probably benign Het
Slc28a3 A G 13: 58,558,278 V639A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpm1 A G 7: 64,217,703 probably benign Het
Ugt1a6a T A 1: 88,138,529 V19E probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Wdr4 T G 17: 31,512,221 Q55P probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfyve16 A T 13: 92,521,261 L714Q probably damaging Het
Other mutations in Cnot6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Cnot6 APN 11 49685266 missense probably benign 0.01
IGL00969:Cnot6 APN 11 49685120 missense probably benign
IGL01655:Cnot6 APN 11 49677304 missense probably damaging 1.00
IGL02074:Cnot6 APN 11 49689243 missense probably benign 0.00
IGL02670:Cnot6 APN 11 49685114 nonsense probably null
R0326:Cnot6 UTSW 11 49677436 missense probably damaging 1.00
R0625:Cnot6 UTSW 11 49683171 missense probably damaging 1.00
R1079:Cnot6 UTSW 11 49685103 missense probably benign 0.01
R3820:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3821:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R4202:Cnot6 UTSW 11 49702636 missense probably damaging 1.00
R4515:Cnot6 UTSW 11 49702536 splice site probably null
R6010:Cnot6 UTSW 11 49683239 nonsense probably null
R6193:Cnot6 UTSW 11 49680023 missense probably benign 0.06
R7149:Cnot6 UTSW 11 49680143 missense probably benign
R7501:Cnot6 UTSW 11 49685332 missense probably benign 0.01
R7556:Cnot6 UTSW 11 49675317 missense probably benign 0.15
R8263:Cnot6 UTSW 11 49682175 missense probably damaging 0.99
RF003:Cnot6 UTSW 11 49702613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTCTGGACAGTCAATTCTTACC -3'
(R):5'- ATTTTGGCAGCCGCTCTATC -3'

Sequencing Primer
(F):5'- AAAGCCATGCCTCCTTTC -3'
(R):5'- GGCAGCCGCTCTATCTAACC -3'
Posted On2015-04-02