Incidental Mutation 'R3824:Tsga10'
ID275247
Institutional Source Beutler Lab
Gene Symbol Tsga10
Ensembl Gene ENSMUSG00000060771
Gene Nametestis specific 10
Synonyms4933432N21Rik, Mtsga10
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37754776-37866429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37834197 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 200 (N200K)
Ref Sequence ENSEMBL: ENSMUSP00000120554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041815] [ENSMUST00000088072] [ENSMUST00000114902] [ENSMUST00000123082] [ENSMUST00000151735] [ENSMUST00000155852] [ENSMUST00000193669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041815
AA Change: N200K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048859
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000088072
AA Change: N200K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085391
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114902
AA Change: N200K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110552
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123082
SMART Domains Protein: ENSMUSP00000141261
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151735
AA Change: N200K

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120554
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155852
SMART Domains Protein: ENSMUSP00000141630
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193669
SMART Domains Protein: ENSMUSP00000142218
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Tsga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tsga10 APN 1 37807070 missense probably damaging 0.99
IGL00579:Tsga10 APN 1 37835453 missense probably damaging 1.00
IGL00837:Tsga10 APN 1 37801911 splice site probably benign
IGL01577:Tsga10 APN 1 37835457 missense possibly damaging 0.85
IGL01727:Tsga10 APN 1 37835274 missense probably damaging 1.00
IGL02037:Tsga10 APN 1 37807017 missense probably benign 0.05
IGL02510:Tsga10 APN 1 37760985 missense possibly damaging 0.89
R0346:Tsga10 UTSW 1 37840519 missense possibly damaging 0.65
R0789:Tsga10 UTSW 1 37801787 missense possibly damaging 0.87
R0961:Tsga10 UTSW 1 37761428 critical splice donor site probably null
R1370:Tsga10 UTSW 1 37835453 missense probably damaging 1.00
R1440:Tsga10 UTSW 1 37819599 missense probably damaging 1.00
R1827:Tsga10 UTSW 1 37835580 missense probably damaging 1.00
R2504:Tsga10 UTSW 1 37815677 missense probably damaging 1.00
R3104:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3105:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3106:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3825:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R4560:Tsga10 UTSW 1 37807082 missense probably benign 0.00
R4773:Tsga10 UTSW 1 37835525 missense probably damaging 1.00
R4927:Tsga10 UTSW 1 37801850 missense probably damaging 1.00
R5036:Tsga10 UTSW 1 37783968 missense possibly damaging 0.65
R5326:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5345:Tsga10 UTSW 1 37763311 missense probably damaging 1.00
R5503:Tsga10 UTSW 1 37760947 makesense probably null
R5542:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5793:Tsga10 UTSW 1 37835459 missense probably damaging 1.00
R6340:Tsga10 UTSW 1 37835185 intron probably benign
R7096:Tsga10 UTSW 1 37840614 missense probably damaging 0.98
R7130:Tsga10 UTSW 1 37783884 missense probably damaging 1.00
R7401:Tsga10 UTSW 1 37834187 missense probably null 1.00
R7609:Tsga10 UTSW 1 37804893 intron probably null
R7649:Tsga10 UTSW 1 37835148 missense unknown
R7773:Tsga10 UTSW 1 37835242 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTCAGTTTTCAGAGGGCTG -3'
(R):5'- AGGCTGCACACTGATGGTAG -3'

Sequencing Primer
(F):5'- CAGTTTTCAGAGGGCTGTATAAAAAC -3'
(R):5'- CTGCACACTGATGGTAGCTAACTG -3'
Posted On2015-04-02