Incidental Mutation 'R3824:Cflar'
ID 275249
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene Name CASP8 and FADD-like apoptosis regulator
Synonyms Cash, c-Flip, Flip, 2310024N18Rik, Casper, A430105C05Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 58750667-58798043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58774856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 218 (Y218N)
Ref Sequence ENSEMBL: ENSMUSP00000109952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114309] [ENSMUST00000114313]
AlphaFold O35732
Predicted Effect probably benign
Transcript: ENSMUST00000069333
AA Change: Y218N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: Y218N

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097722
AA Change: Y221N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031
AA Change: Y221N

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114309
SMART Domains Protein: ENSMUSP00000109948
Gene: ENSMUSG00000026031

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114313
AA Change: Y218N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: Y218N

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164900
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58,771,469 (GRCm39) missense probably benign 0.42
IGL00959:Cflar APN 1 58,768,321 (GRCm39) critical splice donor site probably null
IGL02045:Cflar APN 1 58,791,903 (GRCm39) missense probably benign 0.25
IGL02200:Cflar APN 1 58,791,828 (GRCm39) missense probably damaging 1.00
IGL02382:Cflar APN 1 58,791,840 (GRCm39) missense probably benign 0.14
IGL03032:Cflar APN 1 58,780,179 (GRCm39) missense probably damaging 1.00
Channel_islands UTSW 1 58,793,010 (GRCm39) missense probably benign 0.00
IGL02988:Cflar UTSW 1 58,780,190 (GRCm39) missense possibly damaging 0.58
R1936:Cflar UTSW 1 58,791,784 (GRCm39) nonsense probably null
R2259:Cflar UTSW 1 58,768,280 (GRCm39) missense probably benign 0.16
R2269:Cflar UTSW 1 58,780,206 (GRCm39) critical splice donor site probably null
R3816:Cflar UTSW 1 58,791,582 (GRCm39) missense probably benign 0.24
R4232:Cflar UTSW 1 58,780,152 (GRCm39) missense possibly damaging 0.92
R4644:Cflar UTSW 1 58,770,426 (GRCm39) missense probably damaging 1.00
R4749:Cflar UTSW 1 58,779,431 (GRCm39) missense possibly damaging 0.62
R4765:Cflar UTSW 1 58,771,480 (GRCm39) missense probably damaging 0.98
R4785:Cflar UTSW 1 58,791,726 (GRCm39) missense probably benign 0.34
R5315:Cflar UTSW 1 58,792,961 (GRCm39) missense probably benign 0.34
R5418:Cflar UTSW 1 58,791,810 (GRCm39) missense possibly damaging 0.54
R5509:Cflar UTSW 1 58,791,551 (GRCm39) missense probably benign 0.02
R5858:Cflar UTSW 1 58,793,010 (GRCm39) missense probably benign 0.00
R5899:Cflar UTSW 1 58,791,927 (GRCm39) missense probably benign 0.36
R6048:Cflar UTSW 1 58,780,202 (GRCm39) missense probably benign 0.02
R7065:Cflar UTSW 1 58,770,368 (GRCm39) missense probably damaging 1.00
R7144:Cflar UTSW 1 58,793,007 (GRCm39) missense
R7206:Cflar UTSW 1 58,780,150 (GRCm39) missense
R7384:Cflar UTSW 1 58,791,735 (GRCm39) missense
R7453:Cflar UTSW 1 58,792,956 (GRCm39) missense
R7467:Cflar UTSW 1 58,765,597 (GRCm39) start codon destroyed probably null
R7694:Cflar UTSW 1 58,791,966 (GRCm39) missense
R7808:Cflar UTSW 1 58,750,740 (GRCm39) start gained probably benign
R7890:Cflar UTSW 1 58,791,915 (GRCm39) missense
R8073:Cflar UTSW 1 58,791,981 (GRCm39) missense
R9506:Cflar UTSW 1 58,791,975 (GRCm39) missense
Z1176:Cflar UTSW 1 58,779,472 (GRCm39) critical splice donor site probably null
Z1176:Cflar UTSW 1 58,770,388 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GAGTTAACAGTCCCTGCACTTC -3'
(R):5'- AACATGCTTCGGCTCTTTGAG -3'

Sequencing Primer
(F):5'- AACAGTCCCTGCACTTCATTTTTAGG -3'
(R):5'- TCTTGAACTCGTGGGCACAAG -3'
Posted On 2015-04-02