Incidental Mutation 'R3824:Cflar'
ID275249
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene NameCASP8 and FADD-like apoptosis regulator
SynonymsFlip, 2310024N18Rik, A430105C05Rik, Cash, Casper, c-Flip
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58711508-58758884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58735697 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 218 (Y218N)
Ref Sequence ENSEMBL: ENSMUSP00000109952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114309] [ENSMUST00000114313]
Predicted Effect probably benign
Transcript: ENSMUST00000069333
AA Change: Y218N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: Y218N

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097722
AA Change: Y221N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031
AA Change: Y221N

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114309
SMART Domains Protein: ENSMUSP00000109948
Gene: ENSMUSG00000026031

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114313
AA Change: Y218N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: Y218N

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164900
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58732310 missense probably benign 0.42
IGL00959:Cflar APN 1 58729162 critical splice donor site probably null
IGL02045:Cflar APN 1 58752744 missense probably benign 0.25
IGL02200:Cflar APN 1 58752669 missense probably damaging 1.00
IGL02382:Cflar APN 1 58752681 missense probably benign 0.14
IGL03032:Cflar APN 1 58741020 missense probably damaging 1.00
Channel_islands UTSW 1 58753851 missense probably benign 0.00
IGL02988:Cflar UTSW 1 58741031 missense possibly damaging 0.58
R1936:Cflar UTSW 1 58752625 nonsense probably null
R2259:Cflar UTSW 1 58729121 missense probably benign 0.16
R2269:Cflar UTSW 1 58741047 critical splice donor site probably null
R3816:Cflar UTSW 1 58752423 missense probably benign 0.24
R4232:Cflar UTSW 1 58740993 missense possibly damaging 0.92
R4644:Cflar UTSW 1 58731267 missense probably damaging 1.00
R4749:Cflar UTSW 1 58740272 missense possibly damaging 0.62
R4765:Cflar UTSW 1 58732321 missense probably damaging 0.98
R4785:Cflar UTSW 1 58752567 missense probably benign 0.34
R5315:Cflar UTSW 1 58753802 missense probably benign 0.34
R5418:Cflar UTSW 1 58752651 missense possibly damaging 0.54
R5509:Cflar UTSW 1 58752392 missense probably benign 0.02
R5858:Cflar UTSW 1 58753851 missense probably benign 0.00
R5899:Cflar UTSW 1 58752768 missense probably benign 0.36
R6048:Cflar UTSW 1 58741043 missense probably benign 0.02
R7065:Cflar UTSW 1 58731209 missense probably damaging 1.00
R7144:Cflar UTSW 1 58753848 missense
R7206:Cflar UTSW 1 58740991 missense
R7384:Cflar UTSW 1 58752576 missense
R7453:Cflar UTSW 1 58753797 missense
R7467:Cflar UTSW 1 58726438 start codon destroyed probably null
R7694:Cflar UTSW 1 58752807 missense
R7808:Cflar UTSW 1 58711581 start gained probably benign
R7890:Cflar UTSW 1 58752756 missense
R8073:Cflar UTSW 1 58752822 missense
Z1176:Cflar UTSW 1 58731229 missense
Z1176:Cflar UTSW 1 58740313 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTAACAGTCCCTGCACTTC -3'
(R):5'- AACATGCTTCGGCTCTTTGAG -3'

Sequencing Primer
(F):5'- AACAGTCCCTGCACTTCATTTTTAGG -3'
(R):5'- TCTTGAACTCGTGGGCACAAG -3'
Posted On2015-04-02