Incidental Mutation 'R3824:Pip5kl1'
ID 275250
Institutional Source Beutler Lab
Gene Symbol Pip5kl1
Ensembl Gene ENSMUSG00000046854
Gene Name phosphatidylinositol-4-phosphate 5-kinase-like 1
Synonyms
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 32465238-32473799 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 32473283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055304] [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000100188] [ENSMUST00000102818] [ENSMUST00000179989]
AlphaFold Q6U7H8
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102818
SMART Domains Protein: ENSMUSP00000099882
Gene: ENSMUSG00000079442

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 48 296 4.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124980
Predicted Effect probably null
Transcript: ENSMUST00000179989
SMART Domains Protein: ENSMUSP00000136093
Gene: ENSMUSG00000079442

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 46 296 1.7e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192934
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIP5KL1 is a phosphoinositide kinase-like protein that lacks intrinsic lipid kinase activity but associates with type I PIPKs (see PIP5K1A; MIM 603275) and may play a role in localization of PIPK activity (Chang et al., 2004 [PubMed 14701839]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Pip5kl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Pip5kl1 APN 2 32,473,359 (GRCm39) missense probably benign 0.12
IGL03074:Pip5kl1 APN 2 32,470,353 (GRCm39) missense probably damaging 0.97
IGL03115:Pip5kl1 APN 2 32,470,033 (GRCm39) missense probably damaging 1.00
IGL03235:Pip5kl1 APN 2 32,468,166 (GRCm39) missense probably damaging 0.99
PIT4280001:Pip5kl1 UTSW 2 32,473,470 (GRCm39) missense probably benign 0.06
R0149:Pip5kl1 UTSW 2 32,468,966 (GRCm39) missense possibly damaging 0.70
R0416:Pip5kl1 UTSW 2 32,473,436 (GRCm39) nonsense probably null
R1500:Pip5kl1 UTSW 2 32,466,691 (GRCm39) missense probably benign 0.38
R1887:Pip5kl1 UTSW 2 32,468,517 (GRCm39) missense probably damaging 1.00
R2897:Pip5kl1 UTSW 2 32,473,359 (GRCm39) missense probably benign 0.12
R3937:Pip5kl1 UTSW 2 32,469,124 (GRCm39) missense probably damaging 1.00
R5378:Pip5kl1 UTSW 2 32,469,106 (GRCm39) missense probably benign 0.02
R7257:Pip5kl1 UTSW 2 32,470,443 (GRCm39) critical splice donor site probably null
R7414:Pip5kl1 UTSW 2 32,468,247 (GRCm39) missense possibly damaging 0.69
R7735:Pip5kl1 UTSW 2 32,469,101 (GRCm39) missense possibly damaging 0.70
R8073:Pip5kl1 UTSW 2 32,473,440 (GRCm39) missense possibly damaging 0.92
R8472:Pip5kl1 UTSW 2 32,470,018 (GRCm39) missense probably benign 0.20
R8877:Pip5kl1 UTSW 2 32,468,951 (GRCm39) missense possibly damaging 0.70
R8899:Pip5kl1 UTSW 2 32,469,082 (GRCm39) missense probably benign 0.04
R8953:Pip5kl1 UTSW 2 32,469,991 (GRCm39) missense possibly damaging 0.67
R9234:Pip5kl1 UTSW 2 32,468,211 (GRCm39) missense probably benign 0.01
R9490:Pip5kl1 UTSW 2 32,466,667 (GRCm39) missense probably benign
R9726:Pip5kl1 UTSW 2 32,473,391 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTCACTATTGACTTTGAAG -3'
(R):5'- ACACATGTTCCAGCCGTTTG -3'

Sequencing Primer
(F):5'- AAGTTCAGTTTATATTGGAGCCTGCC -3'
(R):5'- GTTTGCGAAACCCATACACGGTAG -3'
Posted On 2015-04-02