Incidental Mutation 'R3824:Ndufaf1'
ID 275253
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene Name NADH:ubiquinone oxidoreductase complex assembly factor 1
Synonyms 2410001M24Rik, CIA30, CGI-65
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119485927-119493302 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119490752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 105 (V105M)
Ref Sequence ENSEMBL: ENSMUSP00000028768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000110801] [ENSMUST00000110802]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028768
AA Change: V105M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: V105M

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110801
AA Change: V103M

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: V103M

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110802
AA Change: V103M

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: V103M

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154127
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119,490,950 (GRCm39) missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119,488,768 (GRCm39) nonsense probably null
IGL02452:Ndufaf1 APN 2 119,486,907 (GRCm39) missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119,486,280 (GRCm39) splice site probably benign
R1211:Ndufaf1 UTSW 2 119,486,156 (GRCm39) missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119,486,218 (GRCm39) missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119,486,218 (GRCm39) missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119,486,218 (GRCm39) missense probably damaging 1.00
R4942:Ndufaf1 UTSW 2 119,490,547 (GRCm39) missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119,490,893 (GRCm39) missense possibly damaging 0.75
R5460:Ndufaf1 UTSW 2 119,490,958 (GRCm39) missense probably benign 0.02
R5732:Ndufaf1 UTSW 2 119,490,521 (GRCm39) nonsense probably null
R5777:Ndufaf1 UTSW 2 119,490,963 (GRCm39) nonsense probably null
R5919:Ndufaf1 UTSW 2 119,490,709 (GRCm39) missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119,490,534 (GRCm39) missense probably damaging 1.00
R6378:Ndufaf1 UTSW 2 119,486,207 (GRCm39) missense probably damaging 0.99
R7202:Ndufaf1 UTSW 2 119,488,907 (GRCm39) missense probably benign 0.39
R7224:Ndufaf1 UTSW 2 119,488,877 (GRCm39) missense probably damaging 1.00
R7847:Ndufaf1 UTSW 2 119,490,534 (GRCm39) missense probably damaging 1.00
R8208:Ndufaf1 UTSW 2 119,490,827 (GRCm39) missense probably benign 0.01
R8319:Ndufaf1 UTSW 2 119,490,568 (GRCm39) missense probably damaging 1.00
R9236:Ndufaf1 UTSW 2 119,490,712 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCATAAAGCAGGGCACTTCG -3'
(R):5'- TTACCTCCATTTGTGGGTAGTCAC -3'

Sequencing Primer
(F):5'- CAGGGCACTTCGGTTGTTC -3'
(R):5'- AGTCACTGTGTAGACTATTCTTCCAG -3'
Posted On 2015-04-02