Incidental Mutation 'R3824:Capn3'
ID275254
Institutional Source Beutler Lab
Gene Symbol Capn3
Ensembl Gene ENSMUSG00000079110
Gene Namecalpain 3
SynonymsCapa-3, Capa3, Lp82, p94
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120456019-120504913 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 120484483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028748] [ENSMUST00000028749] [ENSMUST00000090028] [ENSMUST00000110716] [ENSMUST00000110719] [ENSMUST00000110721]
Predicted Effect probably benign
Transcript: ENSMUST00000028748
SMART Domains Protein: ENSMUSP00000028748
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
EFh 584 612 5.53e-4 SMART
EFh 614 642 1.8e-3 SMART
EFh 679 707 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028749
SMART Domains Protein: ENSMUSP00000028749
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 56 425 2.09e-212 SMART
calpain_III 428 582 4.27e-90 SMART
Pfam:Calpain_u2 583 653 1.3e-31 PFAM
EFh 696 724 5.53e-4 SMART
EFh 726 754 1.8e-3 SMART
EFh 791 819 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090028
SMART Domains Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
low complexity region 585 599 N/A INTRINSIC
EFh 612 640 5.53e-4 SMART
EFh 642 670 1.8e-3 SMART
EFh 707 735 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110716
SMART Domains Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
EFh 632 660 5.53e-4 SMART
EFh 662 690 1.8e-3 SMART
EFh 727 755 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110719
SMART Domains Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
low complexity region 633 647 N/A INTRINSIC
EFh 660 688 5.53e-4 SMART
EFh 690 718 1.8e-3 SMART
EFh 755 783 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110721
SMART Domains Protein: ENSMUSP00000106349
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 56 377 1.13e-208 SMART
calpain_III 380 534 4.27e-90 SMART
EFh 604 632 5.53e-4 SMART
EFh 634 662 1.8e-3 SMART
EFh 699 727 4.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151924
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in muscle dystrophy. The psoas, soleus, and deltoid muscles are the most severely affected. The mutant allele appears to be preferentially transmitted resulting in ratio distortion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Capn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Capn3 APN 2 120486482 intron probably benign
IGL00976:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL01538:Capn3 APN 2 120502186 splice site probably null
IGL01564:Capn3 APN 2 120480708 missense probably damaging 1.00
IGL02527:Capn3 APN 2 120504485 missense probably damaging 0.99
IGL02605:Capn3 APN 2 120496037 missense probably damaging 0.98
IGL02678:Capn3 APN 2 120502998 missense probably damaging 1.00
IGL02899:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL03255:Capn3 APN 2 120489708 missense probably damaging 1.00
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0276:Capn3 UTSW 2 120488065 splice site probably benign
R0601:Capn3 UTSW 2 120502596 splice site probably null
R0714:Capn3 UTSW 2 120491880 missense probably benign 0.32
R1217:Capn3 UTSW 2 120486421 nonsense probably null
R1530:Capn3 UTSW 2 120482208 missense probably damaging 1.00
R1566:Capn3 UTSW 2 120502993 missense possibly damaging 0.72
R1745:Capn3 UTSW 2 120489689 missense possibly damaging 0.87
R1748:Capn3 UTSW 2 120497013 missense probably benign 0.10
R1861:Capn3 UTSW 2 120486482 intron probably benign
R1960:Capn3 UTSW 2 120463940 missense probably benign 0.00
R1971:Capn3 UTSW 2 120480747 missense possibly damaging 0.95
R1994:Capn3 UTSW 2 120495937 missense probably damaging 1.00
R2043:Capn3 UTSW 2 120491901 missense possibly damaging 0.81
R2254:Capn3 UTSW 2 120501251 missense probably benign 0.01
R2255:Capn3 UTSW 2 120501251 missense probably benign 0.01
R3738:Capn3 UTSW 2 120485287 missense possibly damaging 0.85
R4796:Capn3 UTSW 2 120502998 missense probably damaging 1.00
R5073:Capn3 UTSW 2 120491820 missense probably damaging 1.00
R5116:Capn3 UTSW 2 120485292 missense probably benign 0.00
R5152:Capn3 UTSW 2 120501330 intron probably benign
R5420:Capn3 UTSW 2 120495296 intron probably benign
R5478:Capn3 UTSW 2 120464185 splice site probably null
R5506:Capn3 UTSW 2 120502420 missense probably damaging 0.97
R5664:Capn3 UTSW 2 120477025 missense probably benign 0.04
R5733:Capn3 UTSW 2 120484594 nonsense probably null
R6212:Capn3 UTSW 2 120477186 missense probably benign 0.17
R7176:Capn3 UTSW 2 120504492 missense possibly damaging 0.46
R7219:Capn3 UTSW 2 120503454 missense probably damaging 0.99
R7365:Capn3 UTSW 2 120494814 missense probably damaging 0.98
R7819:Capn3 UTSW 2 120464165 missense probably benign 0.05
R8052:Capn3 UTSW 2 120486386 missense probably benign
R8834:Capn3 UTSW 2 120464053 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGAATCACTTGGGATACACG -3'
(R):5'- CCCACCCCTGTAGTCCTAAATG -3'

Sequencing Primer
(F):5'- GACCTACTATGTCTAGAACTGGGC -3'
(R):5'- AAATGTTTCCCATCCTAAATGTTGCC -3'
Posted On2015-04-02