Incidental Mutation 'R3824:Glmp'
ID 275258
Institutional Source Beutler Lab
Gene Symbol Glmp
Ensembl Gene ENSMUSG00000001418
Gene Name glycosylated lysosomal membrane protein
Synonyms 0610031J06Rik, NCU-G1
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88232330-88235938 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88233718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 107 (V107I)
Ref Sequence ENSEMBL: ENSMUSP00000135575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000131666] [ENSMUST00000177005] [ENSMUST00000176425] [ENSMUST00000176519] [ENSMUST00000164166] [ENSMUST00000168062] [ENSMUST00000154381]
AlphaFold Q9JHJ3
Predicted Effect probably benign
Transcript: ENSMUST00000001452
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000001454
AA Change: V126I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418
AA Change: V126I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131666
SMART Domains Protein: ENSMUSP00000120235
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153716
Predicted Effect possibly damaging
Transcript: ENSMUST00000177005
AA Change: V192I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418
AA Change: V192I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176425
AA Change: V107I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418
AA Change: V107I

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164122
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168062
SMART Domains Protein: ENSMUSP00000131113
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 520 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154381
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168971
SMART Domains Protein: ENSMUSP00000131250
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 38 5.6e-8 PFAM
Meta Mutation Damage Score 0.1363 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Homozygous mutants for this allele displayed spontaneous development of liver fibrosis at 6 months and various hepatic cell phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Glmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Glmp APN 3 88,233,169 (GRCm39) splice site probably null
IGL02551:Glmp APN 3 88,232,389 (GRCm39) start codon destroyed probably null 0.53
IGL03212:Glmp APN 3 88,235,664 (GRCm39) missense probably benign 0.01
R0325:Glmp UTSW 3 88,232,391 (GRCm39) start codon destroyed probably null 0.72
R0719:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R0721:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R1617:Glmp UTSW 3 88,235,426 (GRCm39) splice site probably benign
R1970:Glmp UTSW 3 88,235,177 (GRCm39) missense probably damaging 1.00
R3825:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R4521:Glmp UTSW 3 88,235,346 (GRCm39) missense possibly damaging 0.60
R4697:Glmp UTSW 3 88,235,581 (GRCm39) missense probably damaging 0.99
R4806:Glmp UTSW 3 88,233,320 (GRCm39) intron probably benign
R4823:Glmp UTSW 3 88,232,530 (GRCm39) intron probably benign
R5035:Glmp UTSW 3 88,233,951 (GRCm39) splice site probably benign
R5043:Glmp UTSW 3 88,233,983 (GRCm39) intron probably benign
R5335:Glmp UTSW 3 88,233,962 (GRCm39) intron probably benign
R5592:Glmp UTSW 3 88,233,333 (GRCm39) intron probably benign
R5738:Glmp UTSW 3 88,233,445 (GRCm39) missense probably benign 0.06
R5921:Glmp UTSW 3 88,233,283 (GRCm39) missense probably benign 0.09
R6046:Glmp UTSW 3 88,232,495 (GRCm39) missense probably damaging 0.96
R6103:Glmp UTSW 3 88,235,338 (GRCm39) missense probably benign 0.02
R6859:Glmp UTSW 3 88,235,349 (GRCm39) missense probably benign 0.30
R6943:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R6945:Glmp UTSW 3 88,233,139 (GRCm39) missense probably benign 0.02
R7204:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R7770:Glmp UTSW 3 88,233,077 (GRCm39) missense probably benign 0.39
R8022:Glmp UTSW 3 88,233,827 (GRCm39) missense probably damaging 1.00
R8079:Glmp UTSW 3 88,233,045 (GRCm39) missense probably damaging 0.98
R8296:Glmp UTSW 3 88,233,580 (GRCm39) missense probably benign 0.16
R8986:Glmp UTSW 3 88,233,002 (GRCm39) missense probably benign 0.28
R9266:Glmp UTSW 3 88,233,036 (GRCm39) missense probably damaging 0.98
R9335:Glmp UTSW 3 88,235,563 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTTGCCAACCTGAGTGCC -3'
(R):5'- GGAAGACGGCAGGTGCATATTC -3'

Sequencing Primer
(F):5'- CAACCTGAGTGCCGATTTTCAAGG -3'
(R):5'- GACGGCAGGTGCATATTCATCATC -3'
Posted On 2015-04-02