Incidental Mutation 'R3824:Ints8'
ID 275260
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Name integrator complex subunit 8
Synonyms 2810013E07Rik, D130008D20Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 11199158-11254258 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 11225621 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 645 (Y645*)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
AlphaFold Q80V86
Predicted Effect probably null
Transcript: ENSMUST00000044616
AA Change: Y645*
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: Y645*

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108318
AA Change: Y645*
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: Y645*

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108319
AA Change: Y645*
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: Y645*

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137054
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11,218,679 (GRCm39) splice site probably benign
IGL01925:Ints8 APN 4 11,235,617 (GRCm39) splice site probably benign
IGL02195:Ints8 APN 4 11,221,222 (GRCm39) missense probably damaging 1.00
IGL02215:Ints8 APN 4 11,209,244 (GRCm39) missense probably damaging 1.00
IGL02429:Ints8 APN 4 11,231,720 (GRCm39) missense probably damaging 1.00
IGL02484:Ints8 APN 4 11,208,834 (GRCm39) nonsense probably null
IGL02558:Ints8 APN 4 11,218,771 (GRCm39) missense probably damaging 1.00
IGL02725:Ints8 APN 4 11,239,406 (GRCm39) missense probably benign 0.01
IGL02742:Ints8 APN 4 11,241,627 (GRCm39) missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11,245,896 (GRCm39) missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11,235,565 (GRCm39) missense probably damaging 1.00
IGL03171:Ints8 APN 4 11,231,702 (GRCm39) missense probably benign 0.01
IGL03335:Ints8 APN 4 11,216,460 (GRCm39) missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
P0026:Ints8 UTSW 4 11,225,788 (GRCm39) nonsense probably null
R0054:Ints8 UTSW 4 11,204,595 (GRCm39) utr 3 prime probably benign
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0184:Ints8 UTSW 4 11,218,637 (GRCm39) missense probably benign 0.03
R0299:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0499:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0540:Ints8 UTSW 4 11,252,926 (GRCm39) missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R1232:Ints8 UTSW 4 11,234,587 (GRCm39) missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11,221,204 (GRCm39) missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11,239,461 (GRCm39) missense probably benign 0.22
R1503:Ints8 UTSW 4 11,245,842 (GRCm39) missense probably damaging 0.97
R1587:Ints8 UTSW 4 11,245,722 (GRCm39) critical splice donor site probably null
R1701:Ints8 UTSW 4 11,231,656 (GRCm39) missense probably damaging 1.00
R1721:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1757:Ints8 UTSW 4 11,254,109 (GRCm39) start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11,225,600 (GRCm39) critical splice donor site probably null
R1867:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1868:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1952:Ints8 UTSW 4 11,221,150 (GRCm39) missense probably benign 0.21
R2084:Ints8 UTSW 4 11,230,377 (GRCm39) missense probably benign 0.31
R2108:Ints8 UTSW 4 11,235,552 (GRCm39) missense probably damaging 0.99
R2202:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11,225,725 (GRCm39) missense probably benign 0.29
R2504:Ints8 UTSW 4 11,241,642 (GRCm39) missense probably benign 0.03
R4664:Ints8 UTSW 4 11,227,152 (GRCm39) missense probably benign 0.04
R4703:Ints8 UTSW 4 11,223,785 (GRCm39) missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11,230,367 (GRCm39) nonsense probably null
R5206:Ints8 UTSW 4 11,216,477 (GRCm39) missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11,211,916 (GRCm39) missense probably damaging 1.00
R5505:Ints8 UTSW 4 11,221,143 (GRCm39) missense probably benign 0.18
R5513:Ints8 UTSW 4 11,248,303 (GRCm39) missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11,241,654 (GRCm39) missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11,223,813 (GRCm39) missense probably damaging 1.00
R6007:Ints8 UTSW 4 11,208,845 (GRCm39) missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11,252,891 (GRCm39) missense probably damaging 1.00
R6466:Ints8 UTSW 4 11,252,878 (GRCm39) missense probably damaging 0.99
R6709:Ints8 UTSW 4 11,221,117 (GRCm39) missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11,204,474 (GRCm39) missense probably damaging 1.00
R6998:Ints8 UTSW 4 11,204,537 (GRCm39) missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11,204,574 (GRCm39) missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11,225,613 (GRCm39) missense probably benign 0.01
R7772:Ints8 UTSW 4 11,227,190 (GRCm39) missense probably damaging 0.97
R7872:Ints8 UTSW 4 11,254,062 (GRCm39) missense probably benign 0.00
R7953:Ints8 UTSW 4 11,227,128 (GRCm39) missense probably benign
R8184:Ints8 UTSW 4 11,204,534 (GRCm39) missense probably damaging 1.00
R8301:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
R8708:Ints8 UTSW 4 11,208,824 (GRCm39) critical splice donor site probably null
R8868:Ints8 UTSW 4 11,230,488 (GRCm39) missense probably benign
R9245:Ints8 UTSW 4 11,213,811 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAGAAAGTTTCTCCCGTTACC -3'
(R):5'- GAGGATTGACTGCCTGTTCTC -3'

Sequencing Primer
(F):5'- GAAAGTTTCTCCCGTTACCAATATTC -3'
(R):5'- GGACTTTCCTCACTCCAAACAG -3'
Posted On 2015-04-02