Incidental Mutation 'R3824:Fam205c'
ID275261
Institutional Source Beutler Lab
Gene Symbol Fam205c
Ensembl Gene ENSMUSG00000050141
Gene Namefamily with sequence similarity 205, member C
SynonymsBC049635
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42868004-42874234 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 42873492 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
Predicted Effect probably null
Transcript: ENSMUST00000055944
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107978
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144112
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Fam205c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Fam205c APN 4 42868564 missense probably benign 0.40
IGL01697:Fam205c APN 4 42874163 missense probably benign
IGL02413:Fam205c APN 4 42868549 missense probably damaging 0.99
IGL02450:Fam205c APN 4 42874127 missense probably benign
R0433:Fam205c UTSW 4 42874013 splice site probably benign
R1580:Fam205c UTSW 4 42874020 splice site probably null
R2042:Fam205c UTSW 4 42874030 missense possibly damaging 0.96
R2102:Fam205c UTSW 4 42868558 missense probably benign 0.00
R4192:Fam205c UTSW 4 42874185 utr 5 prime probably benign
R4668:Fam205c UTSW 4 42871608 missense probably benign 0.00
R4690:Fam205c UTSW 4 42873032 splice site probably null
R5743:Fam205c UTSW 4 42873087 missense probably damaging 0.99
R5868:Fam205c UTSW 4 42871711 missense probably damaging 0.96
R6186:Fam205c UTSW 4 42872000 missense possibly damaging 0.95
R6778:Fam205c UTSW 4 42868522 missense possibly damaging 0.94
R6986:Fam205c UTSW 4 42868696 missense possibly damaging 0.90
R7318:Fam205c UTSW 4 42871823 small deletion probably benign
R7413:Fam205c UTSW 4 42871823 small deletion probably benign
R7675:Fam205c UTSW 4 42871823 small deletion probably benign
R7785:Fam205c UTSW 4 42871823 small deletion probably benign
R7842:Fam205c UTSW 4 42871823 small deletion probably benign
RF040:Fam205c UTSW 4 42871823 small deletion probably benign
X0052:Fam205c UTSW 4 42874047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CGTGATCGTCAATGCTCTGAC -3'
(R):5'- GGGACCATAGAGCTGGATTAC -3'

Sequencing Primer
(F):5'- TGACAGCGCCCATCTTGTG -3'
(R):5'- TGACGTCTCCGCTTCATA -3'
Posted On2015-04-02