Mutagenetix > Incidental Mutation

Incidental Mutation 'R3824:Pigo'

275262

Institutional Source

Beutler Lab

Gene Symbol

Pigo

Ensembl Gene

ENSMUSG00000028454

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class O

Synonyms

MMRRC Submission

040885-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43017635-43025819 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43020909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 678 (W678R)

Ref Sequence

ENSEMBL: ENSMUSP00000095713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000098109]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067481
AA Change: W670R

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: W670R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Phosphodiest	173	300	7.3e-17	PFAM
low complexity region	308	321	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
low complexity region	349	360	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
transmembrane domain	448	470	N/A	INTRINSIC
transmembrane domain	477	499	N/A	INTRINSIC
transmembrane domain	509	528	N/A	INTRINSIC
low complexity region	539	559	N/A	INTRINSIC
transmembrane domain	669	688	N/A	INTRINSIC
transmembrane domain	703	722	N/A	INTRINSIC
transmembrane domain	743	765	N/A	INTRINSIC
transmembrane domain	829	851	N/A	INTRINSIC
transmembrane domain	858	880	N/A	INTRINSIC
transmembrane domain	921	940	N/A	INTRINSIC
low complexity region	955	979	N/A	INTRINSIC
transmembrane domain	992	1014	N/A	INTRINSIC
transmembrane domain	1029	1051	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098109
AA Change: W678R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: W678R

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Phosphodiest	129	304	6.5e-18	PFAM
low complexity region	316	329	N/A	INTRINSIC
low complexity region	331	344	N/A	INTRINSIC
low complexity region	357	368	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
transmembrane domain	456	478	N/A	INTRINSIC
transmembrane domain	485	507	N/A	INTRINSIC
transmembrane domain	517	536	N/A	INTRINSIC
low complexity region	547	567	N/A	INTRINSIC
transmembrane domain	677	696	N/A	INTRINSIC
transmembrane domain	711	730	N/A	INTRINSIC
transmembrane domain	751	773	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	866	888	N/A	INTRINSIC
transmembrane domain	953	972	N/A	INTRINSIC
low complexity region	987	1011	N/A	INTRINSIC
transmembrane domain	1024	1046	N/A	INTRINSIC
transmembrane domain	1061	1083	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131506

Predicted Effect

probably benign
Transcript: ENSMUST00000149333

SMART Domains

Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Phosphodiest	123	299	2.7e-18	PFAM
low complexity region	311	324	N/A	INTRINSIC
low complexity region	326	339	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	420	431	N/A	INTRINSIC
low complexity region	450	460	N/A	INTRINSIC
transmembrane domain	531	550	N/A	INTRINSIC
low complexity region	565	589	N/A	INTRINSIC
transmembrane domain	602	624	N/A	INTRINSIC
transmembrane domain	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155429

Meta Mutation Damage Score

0.1475

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	C	17: 35,567,611	C20R	probably benign	Het
6030468B19Rik	A	G	11: 117,802,913	K69E	probably damaging	Het
9430015G10Rik	T	A	4: 156,119,150		probably null	Het
A2ml1	A	G	6: 128,568,763	V467A	probably damaging	Het
Abcc3	T	C	11: 94,368,620		probably null	Het
Acad10	A	T	5: 121,622,818	M941K	probably benign	Het
Agrn	A	G	4: 156,169,302	L1649P	probably damaging	Het
Arhgap12	T	C	18: 6,061,930	R402G	possibly damaging	Het
Atp4b	T	C	8: 13,393,549	Y43C	probably damaging	Het
Btn2a2	T	A	13: 23,480,465	T308S	probably benign	Het
C8b	G	T	4: 104,783,009	A170S	probably benign	Het
Cabyr	T	A	18: 12,751,690	D411E	probably benign	Het
Capn3	T	C	2: 120,484,483		probably benign	Het
Cd200r4	T	C	16: 44,820,950	F19L	probably benign	Het
Cflar	T	A	1: 58,735,697	Y218N	probably benign	Het
Col11a2	T	C	17: 34,054,180	Y630H	probably damaging	Het
Coq6	T	C	12: 84,372,415		probably benign	Het
Drg2	A	G	11: 60,459,508	T98A	possibly damaging	Het
Fam205c	A	G	4: 42,873,492		probably null	Het
Fry	T	A	5: 150,496,419	S1015R	possibly damaging	Het
Gjb4	A	G	4: 127,351,429	S240P	probably benign	Het
Glmp	G	A	3: 88,326,411	V107I	probably damaging	Het
Gls	A	C	1: 52,232,988	M2R	possibly damaging	Het
Gm13078	A	T	4: 143,726,685	H121L	probably benign	Het
Gm5724	T	C	6: 141,754,374	Q144R	possibly damaging	Het
Gm906	G	A	13: 50,245,512	S926F	possibly damaging	Het
Igfbp4	A	G	11: 99,048,235	E27G	probably damaging	Het
Ints8	A	T	4: 11,225,621	Y645*	probably null	Het
Kat6a	G	T	8: 22,862,364	V55F	probably damaging	Het
Kat8	T	A	7: 127,924,482	D292E	possibly damaging	Het
Myo19	T	A	11: 84,885,679	C54S	probably damaging	Het
Myo5b	C	T	18: 74,661,655	H532Y	probably benign	Het
Nckap1	T	C	2: 80,540,560	K357E	possibly damaging	Het
Ndufaf1	C	T	2: 119,660,271	V105M	probably benign	Het
Olfr1076	T	G	2: 86,509,023	L188R	possibly damaging	Het
Olfr1394	A	G	11: 49,160,793	S260G	possibly damaging	Het
Olfr888	A	T	9: 38,108,838	I51F	possibly damaging	Het
Olfr895	T	G	9: 38,268,518	S2A	probably benign	Het
Olfr904	T	A	9: 38,464,526	C162S	probably benign	Het
Palld	T	C	8: 61,709,033	D439G	probably damaging	Het
Pcf11	T	C	7: 92,659,620		probably benign	Het
Pip5kl1	A	T	2: 32,583,271		probably null	Het
Plscr3	G	A	11: 69,850,138	V267M	probably benign	Het
Prom2	A	G	2: 127,535,673		probably benign	Het
Ptk7	A	G	17: 46,565,378	I1049T	probably damaging	Het
Ptprb	A	T	10: 116,350,789	I1743F	probably benign	Het
Ptprm	A	G	17: 66,809,575	V894A	probably benign	Het
Rack1	A	G	11: 48,802,304	T105A	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sdk1	A	G	5: 141,936,049	T267A	probably benign	Het
Sorcs3	T	A	19: 48,722,956	D653E	probably damaging	Het
St8sia1	A	G	6: 142,829,025	L276P	probably damaging	Het
Sync	T	C	4: 129,294,363	V396A	possibly damaging	Het
Taok3	A	G	5: 117,255,937	T592A	probably benign	Het
Tas2r104	T	A	6: 131,685,039	I236F	possibly damaging	Het
Tas2r107	A	C	6: 131,659,330	I252S	probably benign	Het
Tmem259	T	C	10: 79,978,448	N334S	possibly damaging	Het
Tsga10	A	T	1: 37,834,197	N200K	possibly damaging	Het
Usp24	G	A	4: 106,379,066	V984I	probably benign	Het
Vmn1r189	T	A	13: 22,102,212	T152S	probably benign	Het
Vmn1r2	A	T	4: 3,172,413	T111S	probably damaging	Het
Vmn2r74	T	G	7: 85,958,258	N86H	probably damaging	Het
Zfp12	T	C	5: 143,240,322	V72A	probably benign	Het

Other mutations in Pigo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Pigo	APN	4	43021767	missense	possibly damaging	0.63
IGL02176:Pigo	APN	4	43019352	missense	probably benign	0.20
IGL03197:Pigo	APN	4	43022103	missense	possibly damaging	0.92
R0207:Pigo	UTSW	4	43023824	splice site	probably benign
R0464:Pigo	UTSW	4	43019814	missense	probably benign	0.02
R0891:Pigo	UTSW	4	43020519	nonsense	probably null
R1445:Pigo	UTSW	4	43021460	missense	probably benign
R1484:Pigo	UTSW	4	43024779	missense	probably damaging	0.99
R1547:Pigo	UTSW	4	43020689	missense	probably benign	0.01
R1624:Pigo	UTSW	4	43024661	missense	probably damaging	1.00
R1847:Pigo	UTSW	4	43024710	nonsense	probably null
R3110:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3111:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3112:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3850:Pigo	UTSW	4	43025084	missense	probably benign	0.01
R3980:Pigo	UTSW	4	43019231	missense	probably damaging	1.00
R3982:Pigo	UTSW	4	43023482	missense	probably benign	0.00
R4520:Pigo	UTSW	4	43020301	missense	probably benign	0.16
R5033:Pigo	UTSW	4	43019412	missense	probably null	1.00
R5054:Pigo	UTSW	4	43021337	missense	probably damaging	1.00
R5240:Pigo	UTSW	4	43020675	missense	possibly damaging	0.95
R5390:Pigo	UTSW	4	43019645	critical splice donor site	probably null
R5468:Pigo	UTSW	4	43024562	critical splice donor site	probably null
R5775:Pigo	UTSW	4	43023475	missense	probably damaging	1.00
R5839:Pigo	UTSW	4	43022104	missense	probably damaging	1.00
R5924:Pigo	UTSW	4	43023389	nonsense	probably null
R6111:Pigo	UTSW	4	43019724	missense	probably benign	0.18
R6451:Pigo	UTSW	4	43021412	missense	probably benign
R6533:Pigo	UTSW	4	43022697	missense	probably benign	0.07
R6884:Pigo	UTSW	4	43022627	missense	possibly damaging	0.88
R7026:Pigo	UTSW	4	43023380	nonsense	probably null
R7591:Pigo	UTSW	4	43025093	missense	probably benign
R7876:Pigo	UTSW	4	43020671	missense	probably benign	0.00
R8754:Pigo	UTSW	4	43024724	missense	probably benign	0.39
R8794:Pigo	UTSW	4	43023787	missense	possibly damaging	0.48
R9646:Pigo	UTSW	4	43017967	missense	probably damaging	0.99
R9782:Pigo	UTSW	4	43023475	missense	probably damaging	1.00
Z1088:Pigo	UTSW	4	43019409	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCACCAGCACTGTCACAGG -3'
(R):5'- GCCACCTTCTTCTCGGATAG -3'

Sequencing Primer
(F):5'- ACTGTCACAGGCCTCCAGAG -3'
(R):5'- ACTGGGAGGGTCAGCTACTG -3'

Posted On

2015-04-02