Incidental Mutation 'R3824:C8b'
ID 275263
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Name complement component 8, beta polypeptide
Synonyms 4930439B20Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 104623514-104661745 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 104640206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 170 (A170S)
Ref Sequence ENSEMBL: ENSMUSP00000066940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
AlphaFold Q8BH35
Predicted Effect probably benign
Transcript: ENSMUST00000031663
AA Change: A170S

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: A170S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065072
AA Change: A170S

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: A170S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104,658,531 (GRCm39) splice site probably benign
IGL01145:C8b APN 4 104,637,777 (GRCm39) missense probably benign 0.25
IGL01768:C8b APN 4 104,644,151 (GRCm39) missense probably benign 0.00
IGL02347:C8b APN 4 104,644,151 (GRCm39) missense probably benign 0.00
IGL02488:C8b APN 4 104,661,278 (GRCm39) missense probably benign
IGL02957:C8b APN 4 104,623,652 (GRCm39) missense probably benign
IGL02979:C8b APN 4 104,631,585 (GRCm39) missense probably damaging 0.99
IGL02995:C8b APN 4 104,658,525 (GRCm39) splice site probably benign
IGL03294:C8b APN 4 104,637,888 (GRCm39) missense probably benign 0.06
R0568:C8b UTSW 4 104,650,577 (GRCm39) missense probably benign 0.39
R1015:C8b UTSW 4 104,644,157 (GRCm39) missense probably benign 0.19
R1191:C8b UTSW 4 104,650,520 (GRCm39) missense probably damaging 1.00
R1401:C8b UTSW 4 104,641,679 (GRCm39) missense possibly damaging 0.72
R4611:C8b UTSW 4 104,647,841 (GRCm39) missense probably damaging 0.98
R4756:C8b UTSW 4 104,644,083 (GRCm39) missense probably benign
R4845:C8b UTSW 4 104,649,009 (GRCm39) missense possibly damaging 0.87
R5355:C8b UTSW 4 104,637,860 (GRCm39) missense probably benign 0.01
R5436:C8b UTSW 4 104,657,546 (GRCm39) nonsense probably null
R5561:C8b UTSW 4 104,641,645 (GRCm39) missense possibly damaging 0.89
R5967:C8b UTSW 4 104,650,530 (GRCm39) missense possibly damaging 0.79
R6744:C8b UTSW 4 104,631,543 (GRCm39) missense probably damaging 1.00
R6899:C8b UTSW 4 104,644,071 (GRCm39) missense probably benign 0.02
R6977:C8b UTSW 4 104,644,193 (GRCm39) missense possibly damaging 0.82
R7088:C8b UTSW 4 104,650,540 (GRCm39) missense probably benign 0.12
R7224:C8b UTSW 4 104,637,795 (GRCm39) missense probably damaging 1.00
R7278:C8b UTSW 4 104,637,824 (GRCm39) missense probably damaging 1.00
R8058:C8b UTSW 4 104,647,811 (GRCm39) missense probably damaging 0.96
R8437:C8b UTSW 4 104,644,040 (GRCm39) missense probably damaging 1.00
R8821:C8b UTSW 4 104,647,874 (GRCm39) missense probably damaging 1.00
R8831:C8b UTSW 4 104,647,874 (GRCm39) missense probably damaging 1.00
R9139:C8b UTSW 4 104,641,631 (GRCm39) missense probably damaging 1.00
R9237:C8b UTSW 4 104,650,481 (GRCm39) missense probably benign 0.00
R9294:C8b UTSW 4 104,644,192 (GRCm39) missense probably benign 0.04
R9789:C8b UTSW 4 104,640,191 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCTATGCACGAAGATGTC -3'
(R):5'- CACATGGAGGTACCTACTCCTAC -3'

Sequencing Primer
(F):5'- CCCTATGCACGAAGATGTCAGAATG -3'
(R):5'- ATGGAGGTACCTACTCCTACTACCG -3'
Posted On 2015-04-02