Mutagenetix > Incidental Mutations

Incidental Mutation 'R3824:C8b'

275263

Institutional Source

Beutler Lab

Gene Symbol

C8b

Ensembl Gene

ENSMUSG00000029656

Gene Name

complement component 8, beta polypeptide

Synonyms

4930439B20Rik

MMRRC Submission

040885-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104766317-104804548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 104783009 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 170 (A170S)

Ref Sequence

ENSEMBL: ENSMUSP00000066940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]

Predicted Effect

probably benign
Transcript: ENSMUST00000031663
AA Change: A170S

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: A170S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSP1	66	116	3.17e-7	SMART
LDLa	120	156	1.78e-10	SMART
MACPF	290	497	3.6e-65	SMART
Blast:EGF	501	534	9e-12	BLAST
TSP1	547	584	1.17e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065072
AA Change: A170S

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: A170S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSP1	66	116	3.17e-7	SMART
LDLa	120	156	1.78e-10	SMART
MACPF	224	431	3.6e-65	SMART
Blast:EGF	435	468	1e-11	BLAST
TSP1	481	518	1.17e-1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	C	17: 35,567,611	C20R	probably benign	Het
6030468B19Rik	A	G	11: 117,802,913	K69E	probably damaging	Het
9430015G10Rik	T	A	4: 156,119,150		probably null	Het
A2ml1	A	G	6: 128,568,763	V467A	probably damaging	Het
Abcc3	T	C	11: 94,368,620		probably null	Het
Acad10	A	T	5: 121,622,818	M941K	probably benign	Het
Agrn	A	G	4: 156,169,302	L1649P	probably damaging	Het
Arhgap12	T	C	18: 6,061,930	R402G	possibly damaging	Het
Atp4b	T	C	8: 13,393,549	Y43C	probably damaging	Het
Btn2a2	T	A	13: 23,480,465	T308S	probably benign	Het
Cabyr	T	A	18: 12,751,690	D411E	probably benign	Het
Capn3	T	C	2: 120,484,483		probably benign	Het
Cd200r4	T	C	16: 44,820,950	F19L	probably benign	Het
Cflar	T	A	1: 58,735,697	Y218N	probably benign	Het
Col11a2	T	C	17: 34,054,180	Y630H	probably damaging	Het
Coq6	T	C	12: 84,372,415		probably benign	Het
Drg2	A	G	11: 60,459,508	T98A	possibly damaging	Het
Fam205c	A	G	4: 42,873,492		probably null	Het
Fry	T	A	5: 150,496,419	S1015R	possibly damaging	Het
Gjb4	A	G	4: 127,351,429	S240P	probably benign	Het
Glmp	G	A	3: 88,326,411	V107I	probably damaging	Het
Gls	A	C	1: 52,232,988	M2R	possibly damaging	Het
Gm13078	A	T	4: 143,726,685	H121L	probably benign	Het
Gm5724	T	C	6: 141,754,374	Q144R	possibly damaging	Het
Gm906	G	A	13: 50,245,512	S926F	possibly damaging	Het
Igfbp4	A	G	11: 99,048,235	E27G	probably damaging	Het
Ints8	A	T	4: 11,225,621	Y645*	probably null	Het
Kat6a	G	T	8: 22,862,364	V55F	probably damaging	Het
Kat8	T	A	7: 127,924,482	D292E	possibly damaging	Het
Myo19	T	A	11: 84,885,679	C54S	probably damaging	Het
Myo5b	C	T	18: 74,661,655	H532Y	probably benign	Het
Nckap1	T	C	2: 80,540,560	K357E	possibly damaging	Het
Ndufaf1	C	T	2: 119,660,271	V105M	probably benign	Het
Olfr1076	T	G	2: 86,509,023	L188R	possibly damaging	Het
Olfr1394	A	G	11: 49,160,793	S260G	possibly damaging	Het
Olfr888	A	T	9: 38,108,838	I51F	possibly damaging	Het
Olfr895	T	G	9: 38,268,518	S2A	probably benign	Het
Olfr904	T	A	9: 38,464,526	C162S	probably benign	Het
Palld	T	C	8: 61,709,033	D439G	probably damaging	Het
Pcf11	T	C	7: 92,659,620		probably benign	Het
Pigo	A	T	4: 43,020,909	W678R	possibly damaging	Het
Pip5kl1	A	T	2: 32,583,271		probably null	Het
Plscr3	G	A	11: 69,850,138	V267M	probably benign	Het
Prom2	A	G	2: 127,535,673		probably benign	Het
Ptk7	A	G	17: 46,565,378	I1049T	probably damaging	Het
Ptprb	A	T	10: 116,350,789	I1743F	probably benign	Het
Ptprm	A	G	17: 66,809,575	V894A	probably benign	Het
Rack1	A	G	11: 48,802,304	T105A	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sdk1	A	G	5: 141,936,049	T267A	probably benign	Het
Sorcs3	T	A	19: 48,722,956	D653E	probably damaging	Het
St8sia1	A	G	6: 142,829,025	L276P	probably damaging	Het
Sync	T	C	4: 129,294,363	V396A	possibly damaging	Het
Taok3	A	G	5: 117,255,937	T592A	probably benign	Het
Tas2r104	T	A	6: 131,685,039	I236F	possibly damaging	Het
Tas2r107	A	C	6: 131,659,330	I252S	probably benign	Het
Tmem259	T	C	10: 79,978,448	N334S	possibly damaging	Het
Tsga10	A	T	1: 37,834,197	N200K	possibly damaging	Het
Usp24	G	A	4: 106,379,066	V984I	probably benign	Het
Vmn1r189	T	A	13: 22,102,212	T152S	probably benign	Het
Vmn1r2	A	T	4: 3,172,413	T111S	probably damaging	Het
Vmn2r74	T	G	7: 85,958,258	N86H	probably damaging	Het
Zfp12	T	C	5: 143,240,322	V72A	probably benign	Het

Other mutations in C8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00659:C8b	APN	4	104801334	splice site	probably benign
IGL01145:C8b	APN	4	104780580	missense	probably benign	0.25
IGL01768:C8b	APN	4	104786954	missense	probably benign	0.00
IGL02347:C8b	APN	4	104786954	missense	probably benign	0.00
IGL02488:C8b	APN	4	104804081	missense	probably benign
IGL02957:C8b	APN	4	104766455	missense	probably benign
IGL02979:C8b	APN	4	104774388	missense	probably damaging	0.99
IGL02995:C8b	APN	4	104801328	splice site	probably benign
IGL03294:C8b	APN	4	104780691	missense	probably benign	0.06
R0568:C8b	UTSW	4	104793380	missense	probably benign	0.39
R1015:C8b	UTSW	4	104786960	missense	probably benign	0.19
R1191:C8b	UTSW	4	104793323	missense	probably damaging	1.00
R1401:C8b	UTSW	4	104784482	missense	possibly damaging	0.72
R4611:C8b	UTSW	4	104790644	missense	probably damaging	0.98
R4756:C8b	UTSW	4	104786886	missense	probably benign
R4845:C8b	UTSW	4	104791812	missense	possibly damaging	0.87
R5355:C8b	UTSW	4	104780663	missense	probably benign	0.01
R5436:C8b	UTSW	4	104800349	nonsense	probably null
R5561:C8b	UTSW	4	104784448	missense	possibly damaging	0.89
R5967:C8b	UTSW	4	104793333	missense	possibly damaging	0.79
R6744:C8b	UTSW	4	104774346	missense	probably damaging	1.00
R6899:C8b	UTSW	4	104786874	missense	probably benign	0.02
R6977:C8b	UTSW	4	104786996	missense	possibly damaging	0.82
R7088:C8b	UTSW	4	104793343	missense	probably benign	0.12
R7224:C8b	UTSW	4	104780598	missense	probably damaging	1.00
R7278:C8b	UTSW	4	104780627	missense	probably damaging	1.00
R8058:C8b	UTSW	4	104790614	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCCCTATGCACGAAGATGTC -3'
(R):5'- CACATGGAGGTACCTACTCCTAC -3'

Sequencing Primer
(F):5'- CCCTATGCACGAAGATGTCAGAATG -3'
(R):5'- ATGGAGGTACCTACTCCTACTACCG -3'

Posted On

2015-04-02