Mutagenetix > Incidental Mutation

Incidental Mutation 'R3824:Sync'

275266

Institutional Source

Beutler Lab

Gene Symbol

Sync

Ensembl Gene

ENSMUSG00000001333

Gene Name

syncoilin

Synonyms

1110057H03Rik, SNIP4

MMRRC Submission

040885-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R3824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129287617-129308559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129294363 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 396 (V396A)

Ref Sequence

ENSEMBL: ENSMUSP00000099659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102599]

AlphaFold

Q9EPM5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102599
AA Change: V396A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: V396A

Domain	Start	End	E-Value	Type
low complexity region	65	75	N/A	INTRINSIC
Filament	156	453	1.2e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146448

Meta Mutation Damage Score

0.1562

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	C	17: 35,567,611	C20R	probably benign	Het
6030468B19Rik	A	G	11: 117,802,913	K69E	probably damaging	Het
9430015G10Rik	T	A	4: 156,119,150		probably null	Het
A2ml1	A	G	6: 128,568,763	V467A	probably damaging	Het
Abcc3	T	C	11: 94,368,620		probably null	Het
Acad10	A	T	5: 121,622,818	M941K	probably benign	Het
Agrn	A	G	4: 156,169,302	L1649P	probably damaging	Het
Arhgap12	T	C	18: 6,061,930	R402G	possibly damaging	Het
Atp4b	T	C	8: 13,393,549	Y43C	probably damaging	Het
Btn2a2	T	A	13: 23,480,465	T308S	probably benign	Het
C8b	G	T	4: 104,783,009	A170S	probably benign	Het
Cabyr	T	A	18: 12,751,690	D411E	probably benign	Het
Capn3	T	C	2: 120,484,483		probably benign	Het
Cd200r4	T	C	16: 44,820,950	F19L	probably benign	Het
Cflar	T	A	1: 58,735,697	Y218N	probably benign	Het
Col11a2	T	C	17: 34,054,180	Y630H	probably damaging	Het
Coq6	T	C	12: 84,372,415		probably benign	Het
Drg2	A	G	11: 60,459,508	T98A	possibly damaging	Het
Fam205c	A	G	4: 42,873,492		probably null	Het
Fry	T	A	5: 150,496,419	S1015R	possibly damaging	Het
Gjb4	A	G	4: 127,351,429	S240P	probably benign	Het
Glmp	G	A	3: 88,326,411	V107I	probably damaging	Het
Gls	A	C	1: 52,232,988	M2R	possibly damaging	Het
Gm13078	A	T	4: 143,726,685	H121L	probably benign	Het
Gm5724	T	C	6: 141,754,374	Q144R	possibly damaging	Het
Gm906	G	A	13: 50,245,512	S926F	possibly damaging	Het
Igfbp4	A	G	11: 99,048,235	E27G	probably damaging	Het
Ints8	A	T	4: 11,225,621	Y645*	probably null	Het
Kat6a	G	T	8: 22,862,364	V55F	probably damaging	Het
Kat8	T	A	7: 127,924,482	D292E	possibly damaging	Het
Myo19	T	A	11: 84,885,679	C54S	probably damaging	Het
Myo5b	C	T	18: 74,661,655	H532Y	probably benign	Het
Nckap1	T	C	2: 80,540,560	K357E	possibly damaging	Het
Ndufaf1	C	T	2: 119,660,271	V105M	probably benign	Het
Olfr1076	T	G	2: 86,509,023	L188R	possibly damaging	Het
Olfr1394	A	G	11: 49,160,793	S260G	possibly damaging	Het
Olfr888	A	T	9: 38,108,838	I51F	possibly damaging	Het
Olfr895	T	G	9: 38,268,518	S2A	probably benign	Het
Olfr904	T	A	9: 38,464,526	C162S	probably benign	Het
Palld	T	C	8: 61,709,033	D439G	probably damaging	Het
Pcf11	T	C	7: 92,659,620		probably benign	Het
Pigo	A	T	4: 43,020,909	W678R	possibly damaging	Het
Pip5kl1	A	T	2: 32,583,271		probably null	Het
Plscr3	G	A	11: 69,850,138	V267M	probably benign	Het
Prom2	A	G	2: 127,535,673		probably benign	Het
Ptk7	A	G	17: 46,565,378	I1049T	probably damaging	Het
Ptprb	A	T	10: 116,350,789	I1743F	probably benign	Het
Ptprm	A	G	17: 66,809,575	V894A	probably benign	Het
Rack1	A	G	11: 48,802,304	T105A	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sdk1	A	G	5: 141,936,049	T267A	probably benign	Het
Sorcs3	T	A	19: 48,722,956	D653E	probably damaging	Het
St8sia1	A	G	6: 142,829,025	L276P	probably damaging	Het
Taok3	A	G	5: 117,255,937	T592A	probably benign	Het
Tas2r104	T	A	6: 131,685,039	I236F	possibly damaging	Het
Tas2r107	A	C	6: 131,659,330	I252S	probably benign	Het
Tmem259	T	C	10: 79,978,448	N334S	possibly damaging	Het
Tsga10	A	T	1: 37,834,197	N200K	possibly damaging	Het
Usp24	G	A	4: 106,379,066	V984I	probably benign	Het
Vmn1r189	T	A	13: 22,102,212	T152S	probably benign	Het
Vmn1r2	A	T	4: 3,172,413	T111S	probably damaging	Het
Vmn2r74	T	G	7: 85,958,258	N86H	probably damaging	Het
Zfp12	T	C	5: 143,240,322	V72A	probably benign	Het

Other mutations in Sync

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02629:Sync	APN	4	129293951	missense	probably damaging	0.99
PIT4354001:Sync	UTSW	4	129306654	missense	possibly damaging	0.71
R0017:Sync	UTSW	4	129293744	missense	probably damaging	1.00
R0017:Sync	UTSW	4	129293744	missense	probably damaging	1.00
R0242:Sync	UTSW	4	129293721	missense	probably damaging	1.00
R0242:Sync	UTSW	4	129293721	missense	probably damaging	1.00
R0825:Sync	UTSW	4	129293397	missense	probably benign	0.04
R0846:Sync	UTSW	4	129294104	missense	probably benign	0.13
R4151:Sync	UTSW	4	129293726	nonsense	probably null
R4166:Sync	UTSW	4	129306742	intron	probably benign
R4760:Sync	UTSW	4	129293439	missense	probably benign	0.01
R5753:Sync	UTSW	4	129293386	nonsense	probably null
R6120:Sync	UTSW	4	129293751	missense	probably damaging	1.00
R6578:Sync	UTSW	4	129294267	missense	probably damaging	1.00
R6860:Sync	UTSW	4	129287790	critical splice donor site	probably null
R7347:Sync	UTSW	4	129294306	missense	probably benign	0.22
R7612:Sync	UTSW	4	129293582	missense	probably benign	0.11
R9058:Sync	UTSW	4	129293424	missense	probably damaging	0.99
R9145:Sync	UTSW	4	129293825	missense
R9266:Sync	UTSW	4	129293386	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAAAATCTCATGGCCGAGAGC -3'
(R):5'- CCTTGAGCTAAAATATGTCCCTTC -3'

Sequencing Primer
(F):5'- CTGCTCCGGCTCCTGGAAAG -3'
(R):5'- GCTAAAATATGTCCCTTCAGCTGGG -3'

Posted On

2015-04-02