Mutagenetix > Incidental Mutation

Incidental Mutation 'R3824:Agrn'

275269

Institutional Source

Beutler Lab

Gene Symbol

Agrn

Ensembl Gene

ENSMUSG00000041936

Gene Name

agrin

Synonyms

NMF380, Agrin, nmf380

MMRRC Submission

040885-MU

Accession Numbers

Genbank: NM_021604; MGI: 87961

Essential gene?

Possibly non essential (E-score: 0.425) question?

Stock #

R3824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

156165290-156197488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 156169302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1649 (L1649P)

Ref Sequence

ENSEMBL: ENSMUSP00000101200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]

AlphaFold

A2ASQ1

PDB Structure

Crystal structure of the G2 domain of Agrin from Mus Musculus [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000071248

SMART Domains

Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1139	5.57e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105574
AA Change: L1645P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: L1645P

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1678	6.51e-36	SMART
EGF	1699	1735	4.35e-6	SMART
LamG	1771	1907	5.01e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105575
AA Change: L1649P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: L1649P

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1682	9.2e-36	SMART
EGF	1703	1739	4.35e-6	SMART
LamG	1794	1930	5.01e-37	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144749

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154494

Predicted Effect

probably damaging
Transcript: ENSMUST00000180572
AA Change: L1752P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: L1752P

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:NtA	32	159	5.1e-91	PFAM
FOLN	173	198	8.25e-6	SMART
KAZAL	198	244	1.22e-17	SMART
FOLN	249	273	7.58e-5	SMART
EGF_like	249	288	7.38e1	SMART
KAZAL	273	319	1.51e-13	SMART
KAZAL	348	391	1.8e-6	SMART
KAZAL	417	463	1.55e-10	SMART
FOLN	469	491	8.25e-6	SMART
KAZAL	491	536	1.14e-17	SMART
KAZAL	556	601	6.43e-17	SMART
FOLN	603	626	2.94e-2	SMART
KAZAL	614	666	8.96e-16	SMART
low complexity region	672	679	N/A	INTRINSIC
KAZAL	706	752	1.12e-16	SMART
EGF_Lam	795	846	3.29e-15	SMART
EGF_Lam	849	893	6.7e-7	SMART
FOLN	902	924	1.94e-2	SMART
KAZAL	924	971	3.9e-16	SMART
low complexity region	996	1013	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
SEA	1121	1243	2.26e-35	SMART
low complexity region	1249	1276	N/A	INTRINSIC
low complexity region	1290	1305	N/A	INTRINSIC
EGF	1321	1356	1.49e-4	SMART
LamG	1381	1517	4e-45	SMART
EGF	1541	1575	2.23e-3	SMART
EGF	1580	1614	7.13e-2	SMART
LamG	1649	1785	6.51e-36	SMART
EGF	1806	1842	4.35e-6	SMART
LamG	1878	2014	5.01e-37	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181062

Meta Mutation Damage Score

0.8618

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	C	17: 35,567,611	C20R	probably benign	Het
6030468B19Rik	A	G	11: 117,802,913	K69E	probably damaging	Het
9430015G10Rik	T	A	4: 156,119,150		probably null	Het
A2ml1	A	G	6: 128,568,763	V467A	probably damaging	Het
Abcc3	T	C	11: 94,368,620		probably null	Het
Acad10	A	T	5: 121,622,818	M941K	probably benign	Het
Arhgap12	T	C	18: 6,061,930	R402G	possibly damaging	Het
Atp4b	T	C	8: 13,393,549	Y43C	probably damaging	Het
Btn2a2	T	A	13: 23,480,465	T308S	probably benign	Het
C8b	G	T	4: 104,783,009	A170S	probably benign	Het
Cabyr	T	A	18: 12,751,690	D411E	probably benign	Het
Capn3	T	C	2: 120,484,483		probably benign	Het
Cd200r4	T	C	16: 44,820,950	F19L	probably benign	Het
Cflar	T	A	1: 58,735,697	Y218N	probably benign	Het
Col11a2	T	C	17: 34,054,180	Y630H	probably damaging	Het
Coq6	T	C	12: 84,372,415		probably benign	Het
Drg2	A	G	11: 60,459,508	T98A	possibly damaging	Het
Fam205c	A	G	4: 42,873,492		probably null	Het
Fry	T	A	5: 150,496,419	S1015R	possibly damaging	Het
Gjb4	A	G	4: 127,351,429	S240P	probably benign	Het
Glmp	G	A	3: 88,326,411	V107I	probably damaging	Het
Gls	A	C	1: 52,232,988	M2R	possibly damaging	Het
Gm13078	A	T	4: 143,726,685	H121L	probably benign	Het
Gm5724	T	C	6: 141,754,374	Q144R	possibly damaging	Het
Gm906	G	A	13: 50,245,512	S926F	possibly damaging	Het
Igfbp4	A	G	11: 99,048,235	E27G	probably damaging	Het
Ints8	A	T	4: 11,225,621	Y645*	probably null	Het
Kat6a	G	T	8: 22,862,364	V55F	probably damaging	Het
Kat8	T	A	7: 127,924,482	D292E	possibly damaging	Het
Myo19	T	A	11: 84,885,679	C54S	probably damaging	Het
Myo5b	C	T	18: 74,661,655	H532Y	probably benign	Het
Nckap1	T	C	2: 80,540,560	K357E	possibly damaging	Het
Ndufaf1	C	T	2: 119,660,271	V105M	probably benign	Het
Olfr1076	T	G	2: 86,509,023	L188R	possibly damaging	Het
Olfr1394	A	G	11: 49,160,793	S260G	possibly damaging	Het
Olfr888	A	T	9: 38,108,838	I51F	possibly damaging	Het
Olfr895	T	G	9: 38,268,518	S2A	probably benign	Het
Olfr904	T	A	9: 38,464,526	C162S	probably benign	Het
Palld	T	C	8: 61,709,033	D439G	probably damaging	Het
Pcf11	T	C	7: 92,659,620		probably benign	Het
Pigo	A	T	4: 43,020,909	W678R	possibly damaging	Het
Pip5kl1	A	T	2: 32,583,271		probably null	Het
Plscr3	G	A	11: 69,850,138	V267M	probably benign	Het
Prom2	A	G	2: 127,535,673		probably benign	Het
Ptk7	A	G	17: 46,565,378	I1049T	probably damaging	Het
Ptprb	A	T	10: 116,350,789	I1743F	probably benign	Het
Ptprm	A	G	17: 66,809,575	V894A	probably benign	Het
Rack1	A	G	11: 48,802,304	T105A	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sdk1	A	G	5: 141,936,049	T267A	probably benign	Het
Sorcs3	T	A	19: 48,722,956	D653E	probably damaging	Het
St8sia1	A	G	6: 142,829,025	L276P	probably damaging	Het
Sync	T	C	4: 129,294,363	V396A	possibly damaging	Het
Taok3	A	G	5: 117,255,937	T592A	probably benign	Het
Tas2r104	T	A	6: 131,685,039	I236F	possibly damaging	Het
Tas2r107	A	C	6: 131,659,330	I252S	probably benign	Het
Tmem259	T	C	10: 79,978,448	N334S	possibly damaging	Het
Tsga10	A	T	1: 37,834,197	N200K	possibly damaging	Het
Usp24	G	A	4: 106,379,066	V984I	probably benign	Het
Vmn1r189	T	A	13: 22,102,212	T152S	probably benign	Het
Vmn1r2	A	T	4: 3,172,413	T111S	probably damaging	Het
Vmn2r74	T	G	7: 85,958,258	N86H	probably damaging	Het
Zfp12	T	C	5: 143,240,322	V72A	probably benign	Het

Other mutations in Agrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Agrn	APN	4	156170572	splice site	probably benign
IGL00811:Agrn	APN	4	156168774	missense	possibly damaging	0.70
IGL01066:Agrn	APN	4	156177343	missense	probably benign	0.00
IGL01412:Agrn	APN	4	156171034	splice site	probably benign
IGL01414:Agrn	APN	4	156195239	splice site	probably null
IGL02075:Agrn	APN	4	156170210	missense	probably benign	0.40
IGL02609:Agrn	APN	4	156175223	splice site	probably benign
IGL02669:Agrn	APN	4	156174561	splice site	probably benign
IGL02671:Agrn	APN	4	156174561	splice site	probably benign
IGL02672:Agrn	APN	4	156174561	splice site	probably benign
IGL02674:Agrn	APN	4	156174561	splice site	probably benign
IGL02724:Agrn	APN	4	156172807	nonsense	probably null
IGL02804:Agrn	APN	4	156174055	missense	probably benign	0.00
IGL02986:Agrn	APN	4	156178854	missense	possibly damaging	0.84
IGL03160:Agrn	APN	4	156170363	missense	probably damaging	0.98
BB004:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
BB014:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
F6893:Agrn	UTSW	4	156174179	missense	probably benign
R0092:Agrn	UTSW	4	156178953	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0482:Agrn	UTSW	4	156173555	missense	probably damaging	0.98
R0531:Agrn	UTSW	4	156179434	missense	probably benign	0.38
R0536:Agrn	UTSW	4	156179553	missense	probably benign	0.01
R0690:Agrn	UTSW	4	156174453	missense	probably damaging	1.00
R0750:Agrn	UTSW	4	156166937	nonsense	probably null
R1079:Agrn	UTSW	4	156177225	missense	probably damaging	1.00
R1199:Agrn	UTSW	4	156172299	missense	probably benign	0.00
R1222:Agrn	UTSW	4	156177385	missense	probably damaging	0.99
R1534:Agrn	UTSW	4	156176684	missense	probably damaging	1.00
R1587:Agrn	UTSW	4	156179440	missense	probably damaging	0.99
R1625:Agrn	UTSW	4	156172860	missense	probably damaging	1.00
R1698:Agrn	UTSW	4	156166558	missense	probably benign	0.03
R1717:Agrn	UTSW	4	156166519	frame shift	probably null
R1718:Agrn	UTSW	4	156166519	frame shift	probably null
R1721:Agrn	UTSW	4	156175173	nonsense	probably null
R1765:Agrn	UTSW	4	156176827	nonsense	probably null
R1840:Agrn	UTSW	4	156167415	missense	probably damaging	1.00
R1865:Agrn	UTSW	4	156166519	frame shift	probably null
R2105:Agrn	UTSW	4	156177299	nonsense	probably null
R2265:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2266:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2269:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2382:Agrn	UTSW	4	156176516	missense	probably damaging	0.97
R2497:Agrn	UTSW	4	156173811	missense	probably benign	0.28
R2509:Agrn	UTSW	4	156166424	splice site	probably null
R2510:Agrn	UTSW	4	156166424	splice site	probably null
R2511:Agrn	UTSW	4	156166424	splice site	probably null
R2994:Agrn	UTSW	4	156167328	missense	possibly damaging	0.79
R4736:Agrn	UTSW	4	156172401	missense	probably benign	0.38
R4755:Agrn	UTSW	4	156173522	intron	probably benign
R4853:Agrn	UTSW	4	156185550	critical splice donor site	probably null
R4878:Agrn	UTSW	4	156170845	missense	probably damaging	1.00
R5117:Agrn	UTSW	4	156185553	missense	probably benign	0.30
R5228:Agrn	UTSW	4	156166946	missense	probably damaging	1.00
R5236:Agrn	UTSW	4	156178858	missense	possibly damaging	0.93
R5269:Agrn	UTSW	4	156168990	missense	probably benign	0.10
R5282:Agrn	UTSW	4	156173035	missense	probably damaging	1.00
R5449:Agrn	UTSW	4	156167280	critical splice donor site	probably null
R5560:Agrn	UTSW	4	156178497	missense	probably damaging	0.99
R5668:Agrn	UTSW	4	156167313	missense	probably damaging	0.97
R5725:Agrn	UTSW	4	156173875	missense	probably benign	0.25
R5967:Agrn	UTSW	4	156175103	missense	probably damaging	1.00
R6226:Agrn	UTSW	4	156173609	missense	probably damaging	0.96
R6338:Agrn	UTSW	4	156170585	missense	probably benign	0.17
R6351:Agrn	UTSW	4	156179434	missense	probably benign	0.00
R6437:Agrn	UTSW	4	156176778	missense	probably damaging	0.96
R6490:Agrn	UTSW	4	156167362	nonsense	probably null
R6909:Agrn	UTSW	4	156177007	missense	possibly damaging	0.90
R7110:Agrn	UTSW	4	156178875	missense	possibly damaging	0.88
R7123:Agrn	UTSW	4	156172840	missense	probably benign
R7163:Agrn	UTSW	4	156178509	missense	probably damaging	1.00
R7180:Agrn	UTSW	4	156171839	missense	probably benign	0.00
R7251:Agrn	UTSW	4	156174606	missense	probably damaging	1.00
R7289:Agrn	UTSW	4	156178932	missense	probably damaging	1.00
R7335:Agrn	UTSW	4	156176532	missense	probably damaging	1.00
R7336:Agrn	UTSW	4	156174914	nonsense	probably null
R7406:Agrn	UTSW	4	156172301	missense	possibly damaging	0.93
R7460:Agrn	UTSW	4	156174424	missense	probably damaging	0.98
R7531:Agrn	UTSW	4	156169804	missense	probably damaging	1.00
R7585:Agrn	UTSW	4	156170674	missense	probably benign	0.08
R7646:Agrn	UTSW	4	156195354	missense	probably damaging	0.99
R7652:Agrn	UTSW	4	156169218	critical splice donor site	probably null
R7714:Agrn	UTSW	4	156195397	missense	probably damaging	1.00
R7751:Agrn	UTSW	4	156176429	missense	probably damaging	1.00
R7852:Agrn	UTSW	4	156169057	missense	probably benign	0.01
R7927:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
R8039:Agrn	UTSW	4	156169011	missense	probably benign	0.12
R8056:Agrn	UTSW	4	156170411	missense	probably benign
R8061:Agrn	UTSW	4	156178954	missense	probably damaging	1.00
R8158:Agrn	UTSW	4	156173889	missense	probably benign
R8159:Agrn	UTSW	4	156172368	missense	probably benign	0.27
R8325:Agrn	UTSW	4	156173662	missense	probably benign	0.01
R8338:Agrn	UTSW	4	156168561	missense	probably benign	0.01
R8739:Agrn	UTSW	4	156172588	missense	probably benign
R8956:Agrn	UTSW	4	156166538	missense	probably damaging	0.99
R9094:Agrn	UTSW	4	156168807	missense	probably benign	0.01
R9112:Agrn	UTSW	4	156177057	missense	probably damaging	1.00
R9384:Agrn	UTSW	4	156172649	missense	probably damaging	1.00
R9472:Agrn	UTSW	4	156170384	missense
R9619:Agrn	UTSW	4	156174033	missense	probably benign	0.00
R9629:Agrn	UTSW	4	156172637	nonsense	probably null
R9732:Agrn	UTSW	4	156173989	missense	probably benign	0.13
R9749:Agrn	UTSW	4	156173657	missense	probably benign	0.02
R9757:Agrn	UTSW	4	156176778	missense	probably benign	0.03
R9792:Agrn	UTSW	4	156176672	missense	probably benign	0.09
R9793:Agrn	UTSW	4	156176672	missense	probably benign	0.09
Z1177:Agrn	UTSW	4	156171544	nonsense	probably null
Z1177:Agrn	UTSW	4	156179576	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGATGGCCTCTTAGAGACACC -3'
(R):5'- TCCCACTAAGGCCCAATCTG -3'

Sequencing Primer
(F):5'- TGGCCTCTTAGAGACACCTGAAG -3'
(R):5'- GCCATTTCCGTGGGATTAATAC -3'

Posted On

2015-04-02