Incidental Mutation 'R3824:Agrn'
ID275269
Institutional Source Beutler Lab
Gene Symbol Agrn
Ensembl Gene ENSMUSG00000041936
Gene Nameagrin
SynonymsNMF380, Agrin, nmf380
MMRRC Submission 040885-MU
Accession Numbers

Genbank: NM_021604; MGI: 87961

Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156165290-156197488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156169302 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1649 (L1649P)
Ref Sequence ENSEMBL: ENSMUSP00000101200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]
PDB Structure
Crystal structure of the G2 domain of Agrin from Mus Musculus [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000071248
SMART Domains Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1139 5.57e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105574
AA Change: L1645P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: L1645P

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1678 6.51e-36 SMART
EGF 1699 1735 4.35e-6 SMART
LamG 1771 1907 5.01e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105575
AA Change: L1649P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: L1649P

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1682 9.2e-36 SMART
EGF 1703 1739 4.35e-6 SMART
LamG 1794 1930 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154494
Predicted Effect probably damaging
Transcript: ENSMUST00000180572
AA Change: L1752P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: L1752P

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181062
Meta Mutation Damage Score 0.8618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Agrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Agrn APN 4 156170572 splice site probably benign
IGL00811:Agrn APN 4 156168774 missense possibly damaging 0.70
IGL01066:Agrn APN 4 156177343 missense probably benign 0.00
IGL01412:Agrn APN 4 156171034 splice site probably benign
IGL01414:Agrn APN 4 156195239 splice site probably null
IGL02075:Agrn APN 4 156170210 missense probably benign 0.40
IGL02609:Agrn APN 4 156175223 splice site probably benign
IGL02669:Agrn APN 4 156174561 splice site probably benign
IGL02671:Agrn APN 4 156174561 splice site probably benign
IGL02672:Agrn APN 4 156174561 splice site probably benign
IGL02674:Agrn APN 4 156174561 splice site probably benign
IGL02724:Agrn APN 4 156172807 nonsense probably null
IGL02804:Agrn APN 4 156174055 missense probably benign 0.00
IGL02986:Agrn APN 4 156178854 missense possibly damaging 0.84
IGL03160:Agrn APN 4 156170363 missense probably damaging 0.98
F6893:Agrn UTSW 4 156174179 missense probably benign
R0092:Agrn UTSW 4 156178953 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0482:Agrn UTSW 4 156173555 missense probably damaging 0.98
R0531:Agrn UTSW 4 156179434 missense probably benign 0.38
R0536:Agrn UTSW 4 156179553 missense probably benign 0.01
R0690:Agrn UTSW 4 156174453 missense probably damaging 1.00
R0750:Agrn UTSW 4 156166937 nonsense probably null
R1079:Agrn UTSW 4 156177225 missense probably damaging 1.00
R1199:Agrn UTSW 4 156172299 missense probably benign 0.00
R1222:Agrn UTSW 4 156177385 missense probably damaging 0.99
R1534:Agrn UTSW 4 156176684 missense probably damaging 1.00
R1587:Agrn UTSW 4 156179440 missense probably damaging 0.99
R1625:Agrn UTSW 4 156172860 missense probably damaging 1.00
R1698:Agrn UTSW 4 156166558 missense probably benign 0.03
R1717:Agrn UTSW 4 156166519 frame shift probably null
R1718:Agrn UTSW 4 156166519 frame shift probably null
R1721:Agrn UTSW 4 156175173 nonsense probably null
R1765:Agrn UTSW 4 156176827 nonsense probably null
R1840:Agrn UTSW 4 156167415 missense probably damaging 1.00
R1865:Agrn UTSW 4 156166519 frame shift probably null
R2105:Agrn UTSW 4 156177299 nonsense probably null
R2265:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2266:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2269:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2382:Agrn UTSW 4 156176516 missense probably damaging 0.97
R2497:Agrn UTSW 4 156173811 missense probably benign 0.28
R2509:Agrn UTSW 4 156166424 utr 3 prime probably null
R2510:Agrn UTSW 4 156166424 utr 3 prime probably null
R2511:Agrn UTSW 4 156166424 utr 3 prime probably null
R2994:Agrn UTSW 4 156167328 missense possibly damaging 0.79
R4736:Agrn UTSW 4 156172401 missense probably benign 0.38
R4755:Agrn UTSW 4 156173522 intron probably benign
R4853:Agrn UTSW 4 156185550 critical splice donor site probably null
R4878:Agrn UTSW 4 156170845 missense probably damaging 1.00
R5117:Agrn UTSW 4 156185553 missense probably benign 0.30
R5228:Agrn UTSW 4 156166946 missense probably damaging 1.00
R5236:Agrn UTSW 4 156178858 missense possibly damaging 0.93
R5269:Agrn UTSW 4 156168990 missense probably benign 0.10
R5282:Agrn UTSW 4 156173035 missense probably damaging 1.00
R5449:Agrn UTSW 4 156167280 critical splice donor site probably null
R5560:Agrn UTSW 4 156178497 missense probably damaging 0.99
R5668:Agrn UTSW 4 156167313 missense probably damaging 0.97
R5725:Agrn UTSW 4 156173875 missense probably benign 0.25
R5967:Agrn UTSW 4 156175103 missense probably damaging 1.00
R6226:Agrn UTSW 4 156173609 missense probably damaging 0.96
R6338:Agrn UTSW 4 156170585 missense probably benign 0.17
R6351:Agrn UTSW 4 156179434 missense probably benign 0.00
R6437:Agrn UTSW 4 156176778 missense probably damaging 0.96
R6490:Agrn UTSW 4 156167362 nonsense probably null
R6909:Agrn UTSW 4 156177007 missense possibly damaging 0.90
R7110:Agrn UTSW 4 156178875 missense possibly damaging 0.88
R7123:Agrn UTSW 4 156172840 missense probably benign
R7163:Agrn UTSW 4 156178509 missense probably damaging 1.00
R7180:Agrn UTSW 4 156171839 missense probably benign 0.00
R7251:Agrn UTSW 4 156174606 missense probably damaging 1.00
R7289:Agrn UTSW 4 156178932 missense probably damaging 1.00
R7335:Agrn UTSW 4 156176532 missense probably damaging 1.00
R7336:Agrn UTSW 4 156174914 nonsense probably null
R7406:Agrn UTSW 4 156172301 missense possibly damaging 0.93
R7460:Agrn UTSW 4 156174424 missense probably damaging 0.98
R7531:Agrn UTSW 4 156169804 missense probably damaging 1.00
R7585:Agrn UTSW 4 156170674 missense probably benign 0.08
R7646:Agrn UTSW 4 156195354 missense probably damaging 0.99
R7652:Agrn UTSW 4 156169218 critical splice donor site probably null
R7714:Agrn UTSW 4 156195397 missense probably damaging 1.00
R7751:Agrn UTSW 4 156176429 missense probably damaging 1.00
R7852:Agrn UTSW 4 156169057 missense probably benign 0.01
R7935:Agrn UTSW 4 156169057 missense probably benign 0.01
R8039:Agrn UTSW 4 156169011 missense probably benign 0.12
R8056:Agrn UTSW 4 156170411 missense probably benign
R8061:Agrn UTSW 4 156178954 missense probably damaging 1.00
Z1177:Agrn UTSW 4 156171544 nonsense probably null
Z1177:Agrn UTSW 4 156179576 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGATGGCCTCTTAGAGACACC -3'
(R):5'- TCCCACTAAGGCCCAATCTG -3'

Sequencing Primer
(F):5'- TGGCCTCTTAGAGACACCTGAAG -3'
(R):5'- GCCATTTCCGTGGGATTAATAC -3'
Posted On2015-04-02