Incidental Mutation 'R3824:Acad10'
ID275271
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Nameacyl-Coenzyme A dehydrogenase family, member 10
Synonyms2410021P16Rik
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121621026-121660514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121622818 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 941 (M941K)
Ref Sequence ENSEMBL: ENSMUSP00000107400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000041252] [ENSMUST00000111770] [ENSMUST00000111776] [ENSMUST00000197916]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
AA Change: M941K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: M941K

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041252
SMART Domains Protein: ENSMUSP00000046497
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 7e-16 PFAM
Pfam:Acyl-CoA_dh_M 282 383 1.9e-18 PFAM
Pfam:Acyl-CoA_dh_1 395 536 1.5e-27 PFAM
Pfam:Acyl-CoA_dh_2 411 526 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111770
AA Change: M941K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: M941K

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111776
SMART Domains Protein: ENSMUSP00000107406
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 1.9e-15 PFAM
Pfam:Acyl-CoA_dh_M 282 336 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137789
Predicted Effect probably benign
Transcript: ENSMUST00000197916
SMART Domains Protein: ENSMUSP00000142370
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1j97a_ 40 67 1e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121622043 missense probably damaging 1.00
IGL02469:Acad10 APN 5 121645459 missense probably damaging 1.00
IGL02526:Acad10 APN 5 121646860 missense probably damaging 0.99
IGL02623:Acad10 APN 5 121629930 missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121631570 missense probably benign
IGL02685:Acad10 APN 5 121632609 missense probably benign
IGL03139:Acad10 APN 5 121626082 missense probably benign
IGL03267:Acad10 APN 5 121637349 missense probably benign 0.34
P0026:Acad10 UTSW 5 121637352 missense probably damaging 1.00
R0099:Acad10 UTSW 5 121621290 missense probably damaging 1.00
R0453:Acad10 UTSW 5 121627382 nonsense probably null
R1051:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R1052:Acad10 UTSW 5 121649541 missense possibly damaging 0.65
R1116:Acad10 UTSW 5 121630751 missense probably damaging 1.00
R1548:Acad10 UTSW 5 121626040 splice site probably benign
R1548:Acad10 UTSW 5 121626041 splice site probably benign
R1571:Acad10 UTSW 5 121621348 missense probably damaging 0.99
R1592:Acad10 UTSW 5 121645381 missense probably damaging 0.99
R1741:Acad10 UTSW 5 121647836 missense probably damaging 1.00
R1789:Acad10 UTSW 5 121631393 missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121626185 missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121634751 missense probably damaging 1.00
R2085:Acad10 UTSW 5 121649460 missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121629927 missense probably benign 0.23
R2511:Acad10 UTSW 5 121631567 missense probably benign 0.02
R2570:Acad10 UTSW 5 121630204 missense probably damaging 1.00
R3846:Acad10 UTSW 5 121634686 missense probably benign 0.19
R4106:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4107:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4108:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R5569:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R5704:Acad10 UTSW 5 121631543 missense probably benign 0.03
R5845:Acad10 UTSW 5 121626083 missense probably benign
R5990:Acad10 UTSW 5 121645405 missense probably damaging 1.00
R6019:Acad10 UTSW 5 121634801 missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121622033 missense probably damaging 0.97
R6384:Acad10 UTSW 5 121652003 missense probably benign 0.43
R6491:Acad10 UTSW 5 121630157 missense probably damaging 1.00
R6608:Acad10 UTSW 5 121632492 missense probably benign 0.02
R6941:Acad10 UTSW 5 121649357 missense probably damaging 1.00
R7221:Acad10 UTSW 5 121630210 missense probably damaging 1.00
R7283:Acad10 UTSW 5 121649475 missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121630717 nonsense probably null
R7483:Acad10 UTSW 5 121656012 critical splice donor site probably null
R7553:Acad10 UTSW 5 121639255 missense probably damaging 1.00
R7721:Acad10 UTSW 5 121646866 splice site probably null
R8075:Acad10 UTSW 5 121652085 missense probably benign 0.00
R8400:Acad10 UTSW 5 121626205 missense possibly damaging 0.82
X0061:Acad10 UTSW 5 121622813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCCACAGTTTGCCAAAC -3'
(R):5'- CTGCATTGCCTACCTCAGAC -3'

Sequencing Primer
(F):5'- AGGTAGATTCCAGTGTCACCTCAG -3'
(R):5'- GACCCTCAACCCCAGTTAGCTG -3'
Posted On2015-04-02