Incidental Mutation 'R3824:Sdk1'
ID275272
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3824 (G1)
Quality Score208
Status Not validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141936049 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: T7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: T7A

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: T267A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: T267A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 splice site probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
R7985:Sdk1 UTSW 5 142127847 missense probably damaging 1.00
R8129:Sdk1 UTSW 5 142191893 missense probably benign 0.10
R8217:Sdk1 UTSW 5 142211958 missense possibly damaging 0.81
R8249:Sdk1 UTSW 5 142188015 critical splice acceptor site probably null
R8376:Sdk1 UTSW 5 142158621 missense possibly damaging 0.83
R8779:Sdk1 UTSW 5 141962702 missense probably benign 0.00
R8807:Sdk1 UTSW 5 142085627 missense probably damaging 1.00
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense probably null 0.58
Z1177:Sdk1 UTSW 5 141962708 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CATCACCTGCAGTCTGATGGAG -3'
(R):5'- TTCCACTGCAGCTTGGCATC -3'

Sequencing Primer
(F):5'- TGCAGTCTGATGGAGGCCAG -3'
(R):5'- GCGCCAAGTCCCAGATTTG -3'
Posted On2015-04-02