Incidental Mutation 'R3824:Sdk1'
ID 275272
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Name sidekick cell adhesion molecule 1
Synonyms 6720466O15Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R3824 (G1)
Quality Score 208
Status Not validated
Chromosome 5
Chromosomal Location 141227245-142201341 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141921804 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
AlphaFold Q3UH53
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: T7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: T7A

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: T267A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: T267A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142,071,361 (GRCm39) missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142,070,368 (GRCm39) critical splice donor site probably null
IGL00946:Sdk1 APN 5 142,070,368 (GRCm39) critical splice donor site probably null
IGL01394:Sdk1 APN 5 141,598,970 (GRCm39) missense probably benign 0.03
IGL01398:Sdk1 APN 5 141,923,332 (GRCm39) missense probably benign 0.00
IGL01410:Sdk1 APN 5 142,197,875 (GRCm39) missense probably benign 0.30
IGL01525:Sdk1 APN 5 141,985,675 (GRCm39) missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142,071,520 (GRCm39) missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142,170,930 (GRCm39) missense probably benign 0.33
IGL01676:Sdk1 APN 5 142,113,591 (GRCm39) missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142,031,919 (GRCm39) missense probably benign
IGL01929:Sdk1 APN 5 141,938,785 (GRCm39) missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142,071,437 (GRCm39) missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142,020,184 (GRCm39) missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141,938,767 (GRCm39) missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141,938,771 (GRCm39) missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141,595,787 (GRCm39) missense probably benign 0.01
IGL02637:Sdk1 APN 5 142,080,327 (GRCm39) missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142,158,299 (GRCm39) missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142,071,497 (GRCm39) missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141,938,788 (GRCm39) nonsense probably null
PIT4453001:Sdk1 UTSW 5 142,197,793 (GRCm39) missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141,941,987 (GRCm39) missense probably benign 0.08
R0149:Sdk1 UTSW 5 141,842,809 (GRCm39) intron probably benign
R0173:Sdk1 UTSW 5 142,159,564 (GRCm39) splice site probably benign
R0240:Sdk1 UTSW 5 141,984,502 (GRCm39) missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141,984,502 (GRCm39) missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142,129,677 (GRCm39) splice site probably benign
R0245:Sdk1 UTSW 5 141,940,713 (GRCm39) missense probably benign 0.02
R0270:Sdk1 UTSW 5 142,070,321 (GRCm39) missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141,948,476 (GRCm39) missense probably benign 0.05
R0401:Sdk1 UTSW 5 142,031,916 (GRCm39) missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141,923,473 (GRCm39) missense probably benign
R0558:Sdk1 UTSW 5 142,117,820 (GRCm39) missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141,940,713 (GRCm39) missense probably benign 0.02
R0834:Sdk1 UTSW 5 141,227,779 (GRCm39) missense probably benign
R0962:Sdk1 UTSW 5 142,147,630 (GRCm39) missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142,147,621 (GRCm39) missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142,024,078 (GRCm39) missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142,113,591 (GRCm39) missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141,985,705 (GRCm39) missense probably benign 0.00
R1539:Sdk1 UTSW 5 142,080,354 (GRCm39) missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141,984,634 (GRCm39) missense probably benign 0.03
R1574:Sdk1 UTSW 5 141,984,634 (GRCm39) missense probably benign 0.03
R1673:Sdk1 UTSW 5 141,934,261 (GRCm39) missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142,020,292 (GRCm39) missense probably benign 0.00
R1806:Sdk1 UTSW 5 142,147,681 (GRCm39) missense probably benign
R1806:Sdk1 UTSW 5 141,598,950 (GRCm39) missense probably damaging 1.00
R1925:Sdk1 UTSW 5 142,171,040 (GRCm39) missense probably benign 0.09
R1956:Sdk1 UTSW 5 142,080,336 (GRCm39) missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142,129,573 (GRCm39) missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142,170,943 (GRCm39) missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141,778,699 (GRCm39) missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142,032,047 (GRCm39) missense probably benign 0.00
R2187:Sdk1 UTSW 5 142,100,329 (GRCm39) missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141,948,455 (GRCm39) missense probably benign 0.00
R2520:Sdk1 UTSW 5 142,071,526 (GRCm39) missense probably benign 0.19
R2698:Sdk1 UTSW 5 142,197,805 (GRCm39) missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142,070,306 (GRCm39) missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142,031,991 (GRCm39) missense probably benign
R3500:Sdk1 UTSW 5 141,992,371 (GRCm39) splice site probably benign
R3613:Sdk1 UTSW 5 142,105,441 (GRCm39) missense probably damaging 1.00
R3916:Sdk1 UTSW 5 142,036,999 (GRCm39) missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142,036,999 (GRCm39) missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142,100,154 (GRCm39) missense probably benign 0.00
R4160:Sdk1 UTSW 5 142,100,154 (GRCm39) missense probably benign 0.00
R4161:Sdk1 UTSW 5 142,100,154 (GRCm39) missense probably benign 0.00
R4386:Sdk1 UTSW 5 142,080,381 (GRCm39) missense probably damaging 0.99
R4649:Sdk1 UTSW 5 141,992,380 (GRCm39) missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142,170,986 (GRCm39) missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141,944,993 (GRCm39) missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141,568,168 (GRCm39) missense probably benign
R4825:Sdk1 UTSW 5 141,568,049 (GRCm39) missense probably benign 0.11
R4853:Sdk1 UTSW 5 142,132,018 (GRCm39) missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142,147,531 (GRCm39) missense probably benign 0.01
R4928:Sdk1 UTSW 5 141,842,758 (GRCm39) intron probably benign
R5111:Sdk1 UTSW 5 142,113,600 (GRCm39) missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141,942,015 (GRCm39) critical splice donor site probably null
R5246:Sdk1 UTSW 5 142,100,317 (GRCm39) missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141,984,583 (GRCm39) missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142,085,941 (GRCm39) missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142,171,020 (GRCm39) missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141,598,880 (GRCm39) nonsense probably null
R5593:Sdk1 UTSW 5 141,941,879 (GRCm39) missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141,921,853 (GRCm39) missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142,173,900 (GRCm39) missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142,129,626 (GRCm39) missense probably benign 0.00
R5781:Sdk1 UTSW 5 141,921,803 (GRCm39) missense probably benign 0.00
R5846:Sdk1 UTSW 5 142,100,148 (GRCm39) missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141,948,424 (GRCm39) missense probably benign 0.00
R6164:Sdk1 UTSW 5 142,117,824 (GRCm39) missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142,020,181 (GRCm39) missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141,948,464 (GRCm39) missense probably benign 0.00
R6453:Sdk1 UTSW 5 142,082,676 (GRCm39) missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142,032,053 (GRCm39) missense probably benign 0.00
R6996:Sdk1 UTSW 5 142,197,769 (GRCm39) missense probably benign 0.16
R7003:Sdk1 UTSW 5 142,082,489 (GRCm39) missense probably benign 0.01
R7022:Sdk1 UTSW 5 142,080,412 (GRCm39) splice site probably null
R7027:Sdk1 UTSW 5 142,082,481 (GRCm39) splice site probably null
R7098:Sdk1 UTSW 5 142,082,625 (GRCm39) missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142,067,471 (GRCm39) missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142,031,931 (GRCm39) missense probably benign 0.08
R7313:Sdk1 UTSW 5 141,923,377 (GRCm39) missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142,173,897 (GRCm39) missense probably benign 0.05
R7375:Sdk1 UTSW 5 141,984,598 (GRCm39) missense probably benign 0.01
R7446:Sdk1 UTSW 5 142,130,731 (GRCm39) missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141,778,731 (GRCm39) missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141,595,753 (GRCm39) nonsense probably null
R7747:Sdk1 UTSW 5 142,070,246 (GRCm39) missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141,923,434 (GRCm39) missense probably benign
R7985:Sdk1 UTSW 5 142,113,602 (GRCm39) missense probably damaging 1.00
R8129:Sdk1 UTSW 5 142,177,648 (GRCm39) missense probably benign 0.10
R8217:Sdk1 UTSW 5 142,197,713 (GRCm39) missense possibly damaging 0.81
R8249:Sdk1 UTSW 5 142,173,770 (GRCm39) critical splice acceptor site probably null
R8376:Sdk1 UTSW 5 142,144,376 (GRCm39) missense possibly damaging 0.83
R8779:Sdk1 UTSW 5 141,948,457 (GRCm39) missense probably benign 0.00
R8807:Sdk1 UTSW 5 142,071,382 (GRCm39) missense probably damaging 1.00
R8907:Sdk1 UTSW 5 142,070,278 (GRCm39) missense probably damaging 0.99
R8942:Sdk1 UTSW 5 142,082,598 (GRCm39) missense probably damaging 1.00
R8945:Sdk1 UTSW 5 141,598,935 (GRCm39) missense probably benign
R9006:Sdk1 UTSW 5 141,923,321 (GRCm39) missense probably damaging 1.00
R9249:Sdk1 UTSW 5 142,129,550 (GRCm39) missense probably damaging 1.00
R9275:Sdk1 UTSW 5 141,941,953 (GRCm39) missense possibly damaging 0.95
R9345:Sdk1 UTSW 5 142,147,708 (GRCm39) missense probably benign
R9463:Sdk1 UTSW 5 141,948,548 (GRCm39) missense probably benign 0.31
R9549:Sdk1 UTSW 5 141,940,657 (GRCm39) missense possibly damaging 0.95
R9572:Sdk1 UTSW 5 141,595,784 (GRCm39) missense probably damaging 1.00
R9602:Sdk1 UTSW 5 142,071,353 (GRCm39) missense probably damaging 0.99
R9703:Sdk1 UTSW 5 142,100,283 (GRCm39) missense possibly damaging 0.95
R9720:Sdk1 UTSW 5 142,197,796 (GRCm39) missense probably damaging 0.96
R9771:Sdk1 UTSW 5 142,082,624 (GRCm39) missense probably damaging 0.99
X0017:Sdk1 UTSW 5 141,984,535 (GRCm39) missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141,945,065 (GRCm39) missense probably null 0.58
Z1177:Sdk1 UTSW 5 141,948,463 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CATCACCTGCAGTCTGATGGAG -3'
(R):5'- TTCCACTGCAGCTTGGCATC -3'

Sequencing Primer
(F):5'- TGCAGTCTGATGGAGGCCAG -3'
(R):5'- GCGCCAAGTCCCAGATTTG -3'
Posted On 2015-04-02