Incidental Mutation 'R3824:Zfp12'
ID 275273
Institutional Source Beutler Lab
Gene Symbol Zfp12
Ensembl Gene ENSMUSG00000029587
Gene Name zinc finger protein 12
Synonyms Zfp-12, Krox-7
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143220918-143234589 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 143226077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000137971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000075916] [ENSMUST00000077485] [ENSMUST00000162861]
AlphaFold Q7TSI0
Predicted Effect probably benign
Transcript: ENSMUST00000032591
AA Change: Y49H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587
AA Change: Y49H

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075916
AA Change: V72A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137971
Gene: ENSMUSG00000029587
AA Change: V72A

DomainStartEndE-ValueType
KRAB 8 67 6.65e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077485
SMART Domains Protein: ENSMUSP00000076693
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 68 8.91e-21 SMART
low complexity region 156 167 N/A INTRINSIC
Pfam:zf-C2H2_6 183 200 8.8e-1 PFAM
ZnF_C2H2 231 253 4.47e-3 SMART
ZnF_C2H2 259 281 2.43e-4 SMART
ZnF_C2H2 287 309 2.61e-4 SMART
ZnF_C2H2 315 337 1.04e-3 SMART
ZnF_C2H2 343 365 6.08e-5 SMART
ZnF_C2H2 371 393 2.99e-4 SMART
ZnF_C2H2 399 421 9.08e-4 SMART
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 6.32e-3 SMART
ZnF_C2H2 483 505 5.21e-4 SMART
ZnF_C2H2 511 533 9.44e-2 SMART
ZnF_C2H2 539 561 1.72e-4 SMART
ZnF_C2H2 567 589 2.86e-1 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160195
Predicted Effect probably benign
Transcript: ENSMUST00000162861
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Other mutations in Zfp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Zfp12 APN 5 143,230,551 (GRCm39) missense probably damaging 1.00
IGL02870:Zfp12 APN 5 143,231,086 (GRCm39) missense probably damaging 0.99
IGL02975:Zfp12 APN 5 143,229,814 (GRCm39) unclassified probably benign
R0362:Zfp12 UTSW 5 143,230,978 (GRCm39) missense probably damaging 0.97
R0723:Zfp12 UTSW 5 143,230,638 (GRCm39) missense probably damaging 1.00
R1104:Zfp12 UTSW 5 143,231,500 (GRCm39) missense probably damaging 1.00
R1403:Zfp12 UTSW 5 143,230,535 (GRCm39) nonsense probably null
R1403:Zfp12 UTSW 5 143,230,535 (GRCm39) nonsense probably null
R1774:Zfp12 UTSW 5 143,230,984 (GRCm39) missense probably damaging 1.00
R1895:Zfp12 UTSW 5 143,231,133 (GRCm39) missense probably damaging 1.00
R1946:Zfp12 UTSW 5 143,231,133 (GRCm39) missense probably damaging 1.00
R2280:Zfp12 UTSW 5 143,231,248 (GRCm39) missense probably damaging 0.99
R4772:Zfp12 UTSW 5 143,225,755 (GRCm39) missense probably damaging 1.00
R4786:Zfp12 UTSW 5 143,231,257 (GRCm39) missense probably damaging 0.99
R5255:Zfp12 UTSW 5 143,226,134 (GRCm39) missense probably null 0.08
R5496:Zfp12 UTSW 5 143,230,550 (GRCm39) nonsense probably null
R5542:Zfp12 UTSW 5 143,230,240 (GRCm39) missense possibly damaging 0.75
R5637:Zfp12 UTSW 5 143,231,451 (GRCm39) missense probably damaging 1.00
R5742:Zfp12 UTSW 5 143,230,945 (GRCm39) missense probably damaging 1.00
R5907:Zfp12 UTSW 5 143,225,743 (GRCm39) missense probably damaging 1.00
R6701:Zfp12 UTSW 5 143,230,219 (GRCm39) missense probably benign 0.21
R7166:Zfp12 UTSW 5 143,231,257 (GRCm39) missense possibly damaging 0.85
R7188:Zfp12 UTSW 5 143,225,749 (GRCm39) missense probably damaging 0.99
R7285:Zfp12 UTSW 5 143,230,444 (GRCm39) missense probably damaging 1.00
R7404:Zfp12 UTSW 5 143,226,099 (GRCm39) missense probably damaging 1.00
R7902:Zfp12 UTSW 5 143,231,535 (GRCm39) missense probably damaging 0.99
R8085:Zfp12 UTSW 5 143,230,681 (GRCm39) missense probably damaging 1.00
R9147:Zfp12 UTSW 5 143,230,389 (GRCm39) missense probably damaging 1.00
R9148:Zfp12 UTSW 5 143,230,389 (GRCm39) missense probably damaging 1.00
R9172:Zfp12 UTSW 5 143,231,220 (GRCm39) missense probably damaging 1.00
R9302:Zfp12 UTSW 5 143,230,421 (GRCm39) missense probably damaging 1.00
R9783:Zfp12 UTSW 5 143,230,513 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTGAGCAGCTTGTCCTG -3'
(R):5'- AGCTAGGAACCTTTGATTGTGG -3'

Sequencing Primer
(F):5'- TGACTCCCAGAAGGTCTTGAC -3'
(R):5'- ACGGGTGACTGACTGCCTTC -3'
Posted On 2015-04-02