Incidental Mutation 'R3824:Fry'
ID 275274
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene Name FRY microtubule binding protein
Synonyms cg003, 9330186A19Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.469) question?
Stock # R3824 (G1)
Quality Score 152
Status Validated
Chromosome 5
Chromosomal Location 150042110-150421218 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150419884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1015 (S1015R)
Ref Sequence ENSEMBL: ENSMUSP00000144657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087204
AA Change: S3019R

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: S3019R

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200863
AA Change: S651R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202386
Predicted Effect possibly damaging
Transcript: ENSMUST00000202566
AA Change: S1015R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: S1015R

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202571
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150,263,869 (GRCm39) nonsense probably null
IGL00328:Fry APN 5 150,263,869 (GRCm39) nonsense probably null
IGL00841:Fry APN 5 150,346,189 (GRCm39) missense probably benign
IGL00938:Fry APN 5 150,293,645 (GRCm39) missense probably damaging 1.00
IGL01015:Fry APN 5 150,346,252 (GRCm39) missense probably benign 0.18
IGL01401:Fry APN 5 150,362,253 (GRCm39) missense probably benign
IGL01616:Fry APN 5 150,323,064 (GRCm39) missense probably damaging 1.00
IGL01616:Fry APN 5 150,362,276 (GRCm39) splice site probably null
IGL01748:Fry APN 5 150,269,116 (GRCm39) splice site probably benign
IGL01965:Fry APN 5 150,305,086 (GRCm39) missense probably damaging 1.00
IGL02030:Fry APN 5 150,395,083 (GRCm39) splice site probably benign
IGL02079:Fry APN 5 150,323,089 (GRCm39) missense probably damaging 0.97
IGL02087:Fry APN 5 150,327,059 (GRCm39) missense probably benign 0.23
IGL02113:Fry APN 5 150,323,070 (GRCm39) missense probably benign
IGL02209:Fry APN 5 150,360,491 (GRCm39) missense probably benign 0.00
IGL02250:Fry APN 5 150,326,899 (GRCm39) splice site probably benign
IGL02265:Fry APN 5 150,360,618 (GRCm39) missense probably damaging 1.00
IGL02486:Fry APN 5 150,414,642 (GRCm39) missense probably damaging 0.99
IGL02552:Fry APN 5 150,304,375 (GRCm39) missense probably damaging 1.00
IGL02881:Fry APN 5 150,282,516 (GRCm39) missense probably damaging 0.99
IGL03008:Fry APN 5 150,269,021 (GRCm39) missense possibly damaging 0.82
IGL03140:Fry APN 5 150,419,166 (GRCm39) missense probably damaging 0.98
IGL03171:Fry APN 5 150,304,274 (GRCm39) missense probably damaging 1.00
IGL03389:Fry APN 5 150,317,696 (GRCm39) missense probably damaging 1.00
IGL03404:Fry APN 5 150,249,633 (GRCm39) missense probably damaging 1.00
Brook UTSW 5 150,249,597 (GRCm39) missense probably damaging 1.00
haydn UTSW 5 150,341,929 (GRCm39) missense possibly damaging 0.94
miracle UTSW 5 150,360,624 (GRCm39) missense probably damaging 0.99
quickening UTSW 5 150,358,241 (GRCm39) missense probably damaging 1.00
seasons UTSW 5 150,389,902 (GRCm39) missense probably benign 0.06
Vivaldi UTSW 5 150,317,603 (GRCm39) missense possibly damaging 0.80
R0023:Fry UTSW 5 150,374,563 (GRCm39) missense possibly damaging 0.78
R0024:Fry UTSW 5 150,304,268 (GRCm39) missense probably benign 0.03
R0030:Fry UTSW 5 150,296,034 (GRCm39) nonsense probably null
R0053:Fry UTSW 5 150,384,842 (GRCm39) splice site probably benign
R0089:Fry UTSW 5 150,263,892 (GRCm39) missense possibly damaging 0.91
R0212:Fry UTSW 5 150,419,862 (GRCm39) missense probably damaging 0.99
R0241:Fry UTSW 5 150,183,811 (GRCm39) intron probably benign
R0265:Fry UTSW 5 150,358,241 (GRCm39) missense probably damaging 1.00
R0317:Fry UTSW 5 150,394,933 (GRCm39) missense probably damaging 1.00
R0532:Fry UTSW 5 150,402,226 (GRCm39) splice site probably benign
R0532:Fry UTSW 5 150,357,172 (GRCm39) unclassified probably benign
R0599:Fry UTSW 5 150,360,624 (GRCm39) missense probably damaging 0.99
R0631:Fry UTSW 5 150,419,817 (GRCm39) missense possibly damaging 0.82
R0723:Fry UTSW 5 150,419,825 (GRCm39) missense probably damaging 1.00
R0766:Fry UTSW 5 150,326,897 (GRCm39) splice site probably benign
R0790:Fry UTSW 5 150,389,902 (GRCm39) missense probably benign 0.06
R0928:Fry UTSW 5 150,360,549 (GRCm39) missense probably damaging 1.00
R1104:Fry UTSW 5 150,419,754 (GRCm39) missense probably damaging 1.00
R1144:Fry UTSW 5 150,341,929 (GRCm39) missense possibly damaging 0.94
R1172:Fry UTSW 5 150,404,959 (GRCm39) nonsense probably null
R1312:Fry UTSW 5 150,326,897 (GRCm39) splice site probably benign
R1347:Fry UTSW 5 150,419,283 (GRCm39) missense probably damaging 1.00
R1347:Fry UTSW 5 150,419,283 (GRCm39) missense probably damaging 1.00
R1437:Fry UTSW 5 150,233,890 (GRCm39) missense possibly damaging 0.92
R1458:Fry UTSW 5 150,304,324 (GRCm39) missense probably damaging 1.00
R1542:Fry UTSW 5 150,328,431 (GRCm39) missense probably benign 0.13
R1692:Fry UTSW 5 150,293,692 (GRCm39) missense probably damaging 1.00
R1826:Fry UTSW 5 150,360,174 (GRCm39) missense possibly damaging 0.82
R1874:Fry UTSW 5 150,269,386 (GRCm39) missense probably damaging 1.00
R1875:Fry UTSW 5 150,249,597 (GRCm39) missense probably damaging 1.00
R1881:Fry UTSW 5 150,401,511 (GRCm39) missense probably damaging 0.97
R1884:Fry UTSW 5 150,326,985 (GRCm39) missense probably benign 0.00
R1929:Fry UTSW 5 150,324,389 (GRCm39) missense probably null 0.02
R2066:Fry UTSW 5 150,293,584 (GRCm39) splice site probably benign
R2270:Fry UTSW 5 150,324,389 (GRCm39) missense probably null 0.02
R2356:Fry UTSW 5 150,394,897 (GRCm39) missense probably benign
R3720:Fry UTSW 5 150,378,037 (GRCm39) missense probably damaging 1.00
R3773:Fry UTSW 5 150,321,663 (GRCm39) missense probably damaging 0.96
R3902:Fry UTSW 5 150,269,392 (GRCm39) missense probably damaging 1.00
R3923:Fry UTSW 5 150,336,814 (GRCm39) missense probably benign
R4250:Fry UTSW 5 150,233,825 (GRCm39) missense probably damaging 0.99
R4332:Fry UTSW 5 150,305,128 (GRCm39) missense probably damaging 1.00
R4495:Fry UTSW 5 150,233,928 (GRCm39) missense probably damaging 1.00
R4610:Fry UTSW 5 150,309,569 (GRCm39) missense probably damaging 1.00
R4682:Fry UTSW 5 150,346,219 (GRCm39) missense probably damaging 1.00
R4732:Fry UTSW 5 150,309,472 (GRCm39) missense
R4733:Fry UTSW 5 150,309,472 (GRCm39) missense
R4755:Fry UTSW 5 150,321,719 (GRCm39) missense probably damaging 0.99
R4788:Fry UTSW 5 150,323,101 (GRCm39) missense probably benign 0.00
R4803:Fry UTSW 5 150,322,998 (GRCm39) missense probably benign 0.31
R4858:Fry UTSW 5 150,325,108 (GRCm39) missense possibly damaging 0.78
R4872:Fry UTSW 5 150,317,704 (GRCm39) critical splice donor site probably null
R4902:Fry UTSW 5 150,419,168 (GRCm39) missense probably benign 0.43
R4915:Fry UTSW 5 150,402,328 (GRCm39) missense probably benign 0.30
R4938:Fry UTSW 5 150,401,454 (GRCm39) missense probably damaging 1.00
R4983:Fry UTSW 5 150,321,719 (GRCm39) missense probably damaging 1.00
R5004:Fry UTSW 5 150,357,069 (GRCm39) missense probably benign 0.16
R5040:Fry UTSW 5 150,312,319 (GRCm39) missense probably damaging 0.99
R5145:Fry UTSW 5 150,293,689 (GRCm39) missense probably damaging 0.98
R5170:Fry UTSW 5 150,353,319 (GRCm39) missense probably benign 0.03
R5233:Fry UTSW 5 150,393,185 (GRCm39) missense possibly damaging 0.71
R5428:Fry UTSW 5 150,328,824 (GRCm39) missense possibly damaging 0.89
R5468:Fry UTSW 5 150,323,053 (GRCm39) missense probably benign 0.44
R5481:Fry UTSW 5 150,183,784 (GRCm39) missense probably benign 0.01
R5494:Fry UTSW 5 150,314,132 (GRCm39) missense probably damaging 1.00
R5538:Fry UTSW 5 150,419,313 (GRCm39) missense probably damaging 1.00
R5638:Fry UTSW 5 150,282,546 (GRCm39) missense possibly damaging 0.46
R5645:Fry UTSW 5 150,304,332 (GRCm39) missense probably damaging 1.00
R5716:Fry UTSW 5 150,293,686 (GRCm39) nonsense probably null
R5812:Fry UTSW 5 150,323,136 (GRCm39) missense probably damaging 0.99
R5813:Fry UTSW 5 150,323,136 (GRCm39) missense probably damaging 0.99
R5873:Fry UTSW 5 150,302,350 (GRCm39) missense probably damaging 1.00
R5933:Fry UTSW 5 150,314,265 (GRCm39) intron probably benign
R6037:Fry UTSW 5 150,351,644 (GRCm39) missense probably benign 0.03
R6037:Fry UTSW 5 150,351,644 (GRCm39) missense probably benign 0.03
R6158:Fry UTSW 5 150,378,037 (GRCm39) missense probably damaging 1.00
R6178:Fry UTSW 5 150,377,987 (GRCm39) missense probably damaging 1.00
R6481:Fry UTSW 5 150,309,479 (GRCm39) missense probably damaging 1.00
R6562:Fry UTSW 5 150,249,614 (GRCm39) missense probably damaging 1.00
R6676:Fry UTSW 5 150,304,387 (GRCm39) missense probably benign 0.22
R6717:Fry UTSW 5 150,419,777 (GRCm39) missense probably benign 0.00
R6828:Fry UTSW 5 150,389,911 (GRCm39) splice site probably null
R6874:Fry UTSW 5 150,360,768 (GRCm39) missense probably benign 0.00
R6930:Fry UTSW 5 150,351,695 (GRCm39) missense probably benign 0.00
R6963:Fry UTSW 5 150,381,309 (GRCm39) missense probably benign 0.17
R6965:Fry UTSW 5 150,339,685 (GRCm39) missense possibly damaging 0.79
R7051:Fry UTSW 5 150,318,634 (GRCm39) missense possibly damaging 0.93
R7085:Fry UTSW 5 150,362,214 (GRCm39) missense probably benign 0.02
R7108:Fry UTSW 5 150,414,555 (GRCm39) missense
R7108:Fry UTSW 5 150,319,251 (GRCm39) missense probably damaging 1.00
R7115:Fry UTSW 5 150,309,532 (GRCm39) missense probably damaging 1.00
R7116:Fry UTSW 5 150,319,334 (GRCm39) critical splice donor site probably null
R7197:Fry UTSW 5 150,393,232 (GRCm39) missense
R7256:Fry UTSW 5 150,390,251 (GRCm39) missense
R7318:Fry UTSW 5 150,360,458 (GRCm39) missense probably damaging 0.98
R7323:Fry UTSW 5 150,419,814 (GRCm39) missense
R7358:Fry UTSW 5 150,339,788 (GRCm39) missense probably benign
R7361:Fry UTSW 5 150,360,312 (GRCm39) missense possibly damaging 0.92
R7395:Fry UTSW 5 150,304,348 (GRCm39) missense possibly damaging 0.82
R7487:Fry UTSW 5 150,338,039 (GRCm39) missense possibly damaging 0.79
R7491:Fry UTSW 5 150,389,791 (GRCm39) missense
R7574:Fry UTSW 5 150,304,359 (GRCm39) missense probably benign 0.00
R7582:Fry UTSW 5 150,419,847 (GRCm39) missense
R7586:Fry UTSW 5 150,349,683 (GRCm39) missense probably damaging 1.00
R7650:Fry UTSW 5 150,336,883 (GRCm39) missense probably damaging 1.00
R7699:Fry UTSW 5 150,328,792 (GRCm39) missense probably damaging 0.98
R7700:Fry UTSW 5 150,328,792 (GRCm39) missense probably damaging 0.98
R7972:Fry UTSW 5 150,233,861 (GRCm39) missense probably benign 0.05
R8058:Fry UTSW 5 150,419,232 (GRCm39) missense
R8070:Fry UTSW 5 150,401,472 (GRCm39) missense
R8159:Fry UTSW 5 150,322,998 (GRCm39) missense probably benign 0.31
R8202:Fry UTSW 5 150,355,202 (GRCm39) missense probably damaging 1.00
R8261:Fry UTSW 5 150,369,372 (GRCm39) missense probably damaging 1.00
R8279:Fry UTSW 5 150,419,726 (GRCm39) missense
R8338:Fry UTSW 5 150,282,516 (GRCm39) missense probably damaging 0.99
R8370:Fry UTSW 5 150,319,284 (GRCm39) missense probably damaging 1.00
R8673:Fry UTSW 5 150,318,576 (GRCm39) missense possibly damaging 0.91
R8786:Fry UTSW 5 150,317,501 (GRCm39) missense probably benign 0.00
R8815:Fry UTSW 5 150,317,603 (GRCm39) missense possibly damaging 0.80
R8847:Fry UTSW 5 150,309,472 (GRCm39) missense
R9023:Fry UTSW 5 150,360,768 (GRCm39) missense probably benign 0.00
R9025:Fry UTSW 5 150,219,273 (GRCm39) intron probably benign
R9125:Fry UTSW 5 150,269,525 (GRCm39) missense probably damaging 0.97
R9172:Fry UTSW 5 150,336,793 (GRCm39) missense probably benign
R9262:Fry UTSW 5 150,305,109 (GRCm39) missense probably damaging 1.00
R9263:Fry UTSW 5 150,322,728 (GRCm39) missense probably damaging 1.00
R9293:Fry UTSW 5 150,419,297 (GRCm39) missense
R9368:Fry UTSW 5 150,401,403 (GRCm39) missense
R9401:Fry UTSW 5 150,302,403 (GRCm39) missense probably damaging 1.00
R9402:Fry UTSW 5 150,360,318 (GRCm39) missense probably damaging 1.00
R9402:Fry UTSW 5 150,357,161 (GRCm39) missense possibly damaging 0.91
R9420:Fry UTSW 5 150,356,994 (GRCm39) missense possibly damaging 0.72
R9557:Fry UTSW 5 150,389,781 (GRCm39) missense
R9647:Fry UTSW 5 150,292,984 (GRCm39) missense probably damaging 1.00
R9650:Fry UTSW 5 150,369,375 (GRCm39) missense probably damaging 1.00
R9655:Fry UTSW 5 150,362,251 (GRCm39) missense possibly damaging 0.90
R9664:Fry UTSW 5 150,282,488 (GRCm39) missense probably damaging 0.98
R9668:Fry UTSW 5 150,282,318 (GRCm39) missense probably damaging 1.00
R9732:Fry UTSW 5 150,328,758 (GRCm39) missense probably benign 0.00
R9773:Fry UTSW 5 150,322,728 (GRCm39) missense probably damaging 1.00
Z1177:Fry UTSW 5 150,233,902 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATTTCCGTCACCAGACTCTG -3'
(R):5'- TGTCTGTCTCAGGAGGTCCTAG -3'

Sequencing Primer
(F):5'- TGGGACAGACGGGTACTTATGC -3'
(R):5'- CTCGGTTTGGACAGTATTGCTACAC -3'
Posted On 2015-04-02