Incidental Mutation 'R3824:Tas2r104'
ID 275277
Institutional Source Beutler Lab
Gene Symbol Tas2r104
Ensembl Gene ENSMUSG00000061977
Gene Name taste receptor, type 2, member 104
Synonyms mt2r45, Tas2r4, mGR04, T2R04
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 131661799-131662707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 131662002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 236 (I236F)
Ref Sequence ENSEMBL: ENSMUSP00000072237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
AlphaFold Q7M723
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072404
AA Change: I236F

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977
AA Change: I236F

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Meta Mutation Damage Score 0.4213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Tas2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tas2r104 APN 6 131,662,530 (GRCm39) missense probably damaging 1.00
IGL01390:Tas2r104 APN 6 131,662,448 (GRCm39) missense probably benign 0.13
IGL02751:Tas2r104 APN 6 131,662,107 (GRCm39) missense probably damaging 1.00
PIT4585001:Tas2r104 UTSW 6 131,662,521 (GRCm39) missense possibly damaging 0.50
R0218:Tas2r104 UTSW 6 131,662,055 (GRCm39) missense probably damaging 1.00
R0453:Tas2r104 UTSW 6 131,662,304 (GRCm39) missense probably benign 0.00
R0472:Tas2r104 UTSW 6 131,662,434 (GRCm39) missense probably benign 0.06
R0614:Tas2r104 UTSW 6 131,662,165 (GRCm39) missense probably damaging 1.00
R1290:Tas2r104 UTSW 6 131,661,808 (GRCm39) nonsense probably null
R1480:Tas2r104 UTSW 6 131,662,257 (GRCm39) missense probably benign 0.17
R1698:Tas2r104 UTSW 6 131,662,547 (GRCm39) missense probably damaging 1.00
R2050:Tas2r104 UTSW 6 131,662,083 (GRCm39) missense probably damaging 1.00
R2229:Tas2r104 UTSW 6 131,662,095 (GRCm39) missense probably damaging 1.00
R3852:Tas2r104 UTSW 6 131,661,888 (GRCm39) missense probably benign 0.09
R4283:Tas2r104 UTSW 6 131,662,374 (GRCm39) missense probably damaging 1.00
R4583:Tas2r104 UTSW 6 131,662,398 (GRCm39) missense probably benign 0.00
R4710:Tas2r104 UTSW 6 131,662,407 (GRCm39) missense probably damaging 0.96
R4954:Tas2r104 UTSW 6 131,661,968 (GRCm39) missense probably damaging 0.99
R5559:Tas2r104 UTSW 6 131,662,094 (GRCm39) missense probably damaging 1.00
R5765:Tas2r104 UTSW 6 131,662,236 (GRCm39) missense probably benign
R5843:Tas2r104 UTSW 6 131,661,938 (GRCm39) missense probably damaging 0.99
R7304:Tas2r104 UTSW 6 131,662,005 (GRCm39) missense possibly damaging 0.90
R8559:Tas2r104 UTSW 6 131,662,388 (GRCm39) missense probably damaging 1.00
R8864:Tas2r104 UTSW 6 131,662,632 (GRCm39) missense possibly damaging 0.95
R8951:Tas2r104 UTSW 6 131,662,569 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGTGCCAGAACATTCATTTC -3'
(R):5'- GCCAATATGGGGCCCATTTC -3'

Sequencing Primer
(F):5'- GCCAGAACATTCATTTCTCTGTCAAG -3'
(R):5'- GGGCCCATTTCCCTCTTTATTGTAG -3'
Posted On 2015-04-02