Incidental Mutation 'R3824:Kat6a'
ID 275283
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene Name K(lysine) acetyltransferase 6A
Synonyms Zfp220, Myst3, MOZ, 9930021N24Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23349551-23433275 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 23352380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 55 (V55F)
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044331
AA Change: V55F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: V55F

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110696
AA Change: V55F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: V55F

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Meta Mutation Damage Score 0.2426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 23,430,279 (GRCm39) missense unknown
IGL01093:Kat6a APN 8 23,429,337 (GRCm39) missense possibly damaging 0.85
IGL01364:Kat6a APN 8 23,397,716 (GRCm39) missense probably damaging 1.00
IGL01868:Kat6a APN 8 23,416,471 (GRCm39) missense probably damaging 1.00
IGL02477:Kat6a APN 8 23,419,316 (GRCm39) missense probably damaging 1.00
IGL02792:Kat6a APN 8 23,428,316 (GRCm39) missense probably damaging 0.98
IGL03243:Kat6a APN 8 23,400,238 (GRCm39) missense possibly damaging 0.77
Anning UTSW 8 23,422,129 (GRCm39) critical splice acceptor site probably null
Jackal UTSW 8 23,420,190 (GRCm39) missense probably damaging 0.99
lobo UTSW 8 23,400,265 (GRCm39) missense probably damaging 0.99
lord UTSW 8 23,352,380 (GRCm39) missense probably damaging 1.00
master UTSW 8 23,352,804 (GRCm39) missense probably damaging 0.99
R0018:Kat6a UTSW 8 23,419,289 (GRCm39) missense possibly damaging 0.74
R0018:Kat6a UTSW 8 23,419,289 (GRCm39) missense possibly damaging 0.74
R0284:Kat6a UTSW 8 23,429,819 (GRCm39) missense unknown
R0636:Kat6a UTSW 8 23,429,339 (GRCm39) missense possibly damaging 0.73
R0883:Kat6a UTSW 8 23,352,230 (GRCm39) missense probably damaging 1.00
R1457:Kat6a UTSW 8 23,428,668 (GRCm39) missense probably benign
R1753:Kat6a UTSW 8 23,425,813 (GRCm39) missense probably benign 0.09
R2059:Kat6a UTSW 8 23,429,321 (GRCm39) missense possibly damaging 0.53
R2155:Kat6a UTSW 8 23,425,663 (GRCm39) small deletion probably benign
R2764:Kat6a UTSW 8 23,422,194 (GRCm39) missense probably damaging 1.00
R3724:Kat6a UTSW 8 23,352,804 (GRCm39) missense probably damaging 0.99
R3825:Kat6a UTSW 8 23,352,380 (GRCm39) missense probably damaging 1.00
R4370:Kat6a UTSW 8 23,401,945 (GRCm39) missense possibly damaging 0.95
R4371:Kat6a UTSW 8 23,401,945 (GRCm39) missense possibly damaging 0.95
R4457:Kat6a UTSW 8 23,422,129 (GRCm39) critical splice acceptor site probably null
R4600:Kat6a UTSW 8 23,429,327 (GRCm39) missense probably benign 0.18
R4792:Kat6a UTSW 8 23,430,592 (GRCm39) missense unknown
R4896:Kat6a UTSW 8 23,428,329 (GRCm39) missense probably benign 0.07
R5069:Kat6a UTSW 8 23,393,149 (GRCm39) missense probably damaging 1.00
R5192:Kat6a UTSW 8 23,401,729 (GRCm39) missense probably damaging 0.99
R5196:Kat6a UTSW 8 23,401,729 (GRCm39) missense probably damaging 0.99
R5279:Kat6a UTSW 8 23,429,664 (GRCm39) small deletion probably benign
R5331:Kat6a UTSW 8 23,430,000 (GRCm39) missense unknown
R5480:Kat6a UTSW 8 23,428,323 (GRCm39) missense possibly damaging 0.77
R5659:Kat6a UTSW 8 23,428,176 (GRCm39) nonsense probably null
R5759:Kat6a UTSW 8 23,428,028 (GRCm39) missense probably benign 0.04
R5787:Kat6a UTSW 8 23,422,663 (GRCm39) missense probably damaging 0.99
R5892:Kat6a UTSW 8 23,428,305 (GRCm39) missense probably damaging 1.00
R5923:Kat6a UTSW 8 23,429,495 (GRCm39) missense probably benign 0.00
R6049:Kat6a UTSW 8 23,429,053 (GRCm39) missense possibly damaging 0.53
R6223:Kat6a UTSW 8 23,430,442 (GRCm39) missense unknown
R6276:Kat6a UTSW 8 23,429,421 (GRCm39) missense possibly damaging 0.96
R6279:Kat6a UTSW 8 23,429,628 (GRCm39) missense unknown
R6300:Kat6a UTSW 8 23,429,628 (GRCm39) missense unknown
R6307:Kat6a UTSW 8 23,430,384 (GRCm39) missense unknown
R6562:Kat6a UTSW 8 23,401,803 (GRCm39) missense probably benign 0.04
R6807:Kat6a UTSW 8 23,430,384 (GRCm39) missense unknown
R6852:Kat6a UTSW 8 23,428,676 (GRCm39) missense probably benign 0.18
R6875:Kat6a UTSW 8 23,422,377 (GRCm39) missense probably benign 0.02
R6895:Kat6a UTSW 8 23,425,799 (GRCm39) missense possibly damaging 0.88
R6913:Kat6a UTSW 8 23,393,215 (GRCm39) missense possibly damaging 0.53
R7047:Kat6a UTSW 8 23,428,554 (GRCm39) missense possibly damaging 0.53
R7235:Kat6a UTSW 8 23,404,285 (GRCm39) missense possibly damaging 0.94
R7243:Kat6a UTSW 8 23,428,791 (GRCm39) missense probably benign 0.00
R7454:Kat6a UTSW 8 23,425,788 (GRCm39) missense possibly damaging 0.56
R7618:Kat6a UTSW 8 23,352,578 (GRCm39) missense possibly damaging 0.95
R7768:Kat6a UTSW 8 23,393,228 (GRCm39) missense probably damaging 1.00
R7980:Kat6a UTSW 8 23,416,432 (GRCm39) missense possibly damaging 0.95
R8051:Kat6a UTSW 8 23,400,265 (GRCm39) missense probably damaging 0.99
R8408:Kat6a UTSW 8 23,352,275 (GRCm39) missense probably damaging 1.00
R8725:Kat6a UTSW 8 23,398,293 (GRCm39) missense probably damaging 1.00
R8743:Kat6a UTSW 8 23,429,022 (GRCm39) missense possibly damaging 0.85
R8904:Kat6a UTSW 8 23,428,824 (GRCm39) missense possibly damaging 0.85
R9014:Kat6a UTSW 8 23,430,087 (GRCm39) missense unknown
R9019:Kat6a UTSW 8 23,425,754 (GRCm39) missense probably damaging 0.98
R9091:Kat6a UTSW 8 23,420,190 (GRCm39) missense probably damaging 0.99
R9142:Kat6a UTSW 8 23,430,072 (GRCm39) missense unknown
R9229:Kat6a UTSW 8 23,429,987 (GRCm39) missense unknown
R9270:Kat6a UTSW 8 23,420,190 (GRCm39) missense probably damaging 0.99
R9367:Kat6a UTSW 8 23,400,156 (GRCm39) missense possibly damaging 0.76
R9421:Kat6a UTSW 8 23,398,322 (GRCm39) missense probably damaging 1.00
X0050:Kat6a UTSW 8 23,430,497 (GRCm39) nonsense probably null
Z1088:Kat6a UTSW 8 23,425,517 (GRCm39) nonsense probably null
Z1176:Kat6a UTSW 8 23,400,170 (GRCm39) missense probably damaging 1.00
Z1177:Kat6a UTSW 8 23,430,182 (GRCm39) missense unknown
Z1190:Kat6a UTSW 8 23,430,245 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCATCAGGATAAGGGATAACGACTC -3'
(R):5'- AAGTTGAGCCACCAGTCTCTG -3'

Sequencing Primer
(F):5'- GGATATACAGAATCCTTCACCATGG -3'
(R):5'- GTCTCTGCCAAGCCCTCAAATG -3'
Posted On 2015-04-02