Mutagenetix > Incidental Mutation

Incidental Mutation 'R3824:Olfr888'

275285

Institutional Source

Beutler Lab

Gene Symbol

Olfr888

Ensembl Gene

ENSMUSG00000095527

Gene Name

olfactory receptor 888

Synonyms

GA_x6K02T2PVTD-31787920-31788864, MOR162-4

MMRRC Submission

040885-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R3824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38108128-38111381 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38108838 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 51 (I51F)

Ref Sequence

ENSEMBL: ENSMUSP00000074713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075228] [ENSMUST00000211851]

AlphaFold

Q9EQA5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075228
AA Change: I51F

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000074713
Gene: ENSMUSG00000095527
AA Change: I51F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	36	311	8.8e-49	PFAM
Pfam:7tm_1	46	293	3.9e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211851
AA Change: I46F

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	C	17: 35,567,611	C20R	probably benign	Het
6030468B19Rik	A	G	11: 117,802,913	K69E	probably damaging	Het
9430015G10Rik	T	A	4: 156,119,150		probably null	Het
A2ml1	A	G	6: 128,568,763	V467A	probably damaging	Het
Abcc3	T	C	11: 94,368,620		probably null	Het
Acad10	A	T	5: 121,622,818	M941K	probably benign	Het
Agrn	A	G	4: 156,169,302	L1649P	probably damaging	Het
Arhgap12	T	C	18: 6,061,930	R402G	possibly damaging	Het
Atp4b	T	C	8: 13,393,549	Y43C	probably damaging	Het
Btn2a2	T	A	13: 23,480,465	T308S	probably benign	Het
C8b	G	T	4: 104,783,009	A170S	probably benign	Het
Cabyr	T	A	18: 12,751,690	D411E	probably benign	Het
Capn3	T	C	2: 120,484,483		probably benign	Het
Cd200r4	T	C	16: 44,820,950	F19L	probably benign	Het
Cflar	T	A	1: 58,735,697	Y218N	probably benign	Het
Col11a2	T	C	17: 34,054,180	Y630H	probably damaging	Het
Coq6	T	C	12: 84,372,415		probably benign	Het
Drg2	A	G	11: 60,459,508	T98A	possibly damaging	Het
Fam205c	A	G	4: 42,873,492		probably null	Het
Fry	T	A	5: 150,496,419	S1015R	possibly damaging	Het
Gjb4	A	G	4: 127,351,429	S240P	probably benign	Het
Glmp	G	A	3: 88,326,411	V107I	probably damaging	Het
Gls	A	C	1: 52,232,988	M2R	possibly damaging	Het
Gm13078	A	T	4: 143,726,685	H121L	probably benign	Het
Gm5724	T	C	6: 141,754,374	Q144R	possibly damaging	Het
Gm906	G	A	13: 50,245,512	S926F	possibly damaging	Het
Igfbp4	A	G	11: 99,048,235	E27G	probably damaging	Het
Ints8	A	T	4: 11,225,621	Y645*	probably null	Het
Kat6a	G	T	8: 22,862,364	V55F	probably damaging	Het
Kat8	T	A	7: 127,924,482	D292E	possibly damaging	Het
Myo19	T	A	11: 84,885,679	C54S	probably damaging	Het
Myo5b	C	T	18: 74,661,655	H532Y	probably benign	Het
Nckap1	T	C	2: 80,540,560	K357E	possibly damaging	Het
Ndufaf1	C	T	2: 119,660,271	V105M	probably benign	Het
Olfr1076	T	G	2: 86,509,023	L188R	possibly damaging	Het
Olfr1394	A	G	11: 49,160,793	S260G	possibly damaging	Het
Olfr895	T	G	9: 38,268,518	S2A	probably benign	Het
Olfr904	T	A	9: 38,464,526	C162S	probably benign	Het
Palld	T	C	8: 61,709,033	D439G	probably damaging	Het
Pcf11	T	C	7: 92,659,620		probably benign	Het
Pigo	A	T	4: 43,020,909	W678R	possibly damaging	Het
Pip5kl1	A	T	2: 32,583,271		probably null	Het
Plscr3	G	A	11: 69,850,138	V267M	probably benign	Het
Prom2	A	G	2: 127,535,673		probably benign	Het
Ptk7	A	G	17: 46,565,378	I1049T	probably damaging	Het
Ptprb	A	T	10: 116,350,789	I1743F	probably benign	Het
Ptprm	A	G	17: 66,809,575	V894A	probably benign	Het
Rack1	A	G	11: 48,802,304	T105A	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sdk1	A	G	5: 141,936,049	T267A	probably benign	Het
Sorcs3	T	A	19: 48,722,956	D653E	probably damaging	Het
St8sia1	A	G	6: 142,829,025	L276P	probably damaging	Het
Sync	T	C	4: 129,294,363	V396A	possibly damaging	Het
Taok3	A	G	5: 117,255,937	T592A	probably benign	Het
Tas2r104	T	A	6: 131,685,039	I236F	possibly damaging	Het
Tas2r107	A	C	6: 131,659,330	I252S	probably benign	Het
Tmem259	T	C	10: 79,978,448	N334S	possibly damaging	Het
Tsga10	A	T	1: 37,834,197	N200K	possibly damaging	Het
Usp24	G	A	4: 106,379,066	V984I	probably benign	Het
Vmn1r189	T	A	13: 22,102,212	T152S	probably benign	Het
Vmn1r2	A	T	4: 3,172,413	T111S	probably damaging	Het
Vmn2r74	T	G	7: 85,958,258	N86H	probably damaging	Het
Zfp12	T	C	5: 143,240,322	V72A	probably benign	Het

Other mutations in Olfr888

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Olfr888	APN	9	38109562	missense	probably damaging	1.00
IGL02158:Olfr888	APN	9	38109129	missense	probably benign	0.09
IGL02713:Olfr888	APN	9	38109327	missense	probably damaging	0.99
BB007:Olfr888	UTSW	9	38108968	missense	possibly damaging	0.60
BB017:Olfr888	UTSW	9	38108968	missense	possibly damaging	0.60
R0007:Olfr888	UTSW	9	38109094	missense	possibly damaging	0.94
R0125:Olfr888	UTSW	9	38109519	missense	probably benign	0.03
R0310:Olfr888	UTSW	9	38109486	missense	possibly damaging	0.54
R1671:Olfr888	UTSW	9	38109132	missense	probably benign
R3687:Olfr888	UTSW	9	38108881	missense	probably damaging	1.00
R3704:Olfr888	UTSW	9	38109003	missense	possibly damaging	0.95
R3708:Olfr888	UTSW	9	38109444	missense	probably damaging	0.99
R3825:Olfr888	UTSW	9	38108838	missense	possibly damaging	0.71
R4254:Olfr888	UTSW	9	38109250	missense	probably damaging	1.00
R4828:Olfr888	UTSW	9	38108740	missense	probably damaging	0.98
R7265:Olfr888	UTSW	9	38108931	missense	possibly damaging	0.78
R7918:Olfr888	UTSW	9	38108807	nonsense	probably null
R7930:Olfr888	UTSW	9	38108968	missense	possibly damaging	0.60
R8062:Olfr888	UTSW	9	38108917	missense	probably damaging	1.00
R8355:Olfr888	UTSW	9	38108962	missense	probably benign	0.00
R9213:Olfr888	UTSW	9	38109130	missense	possibly damaging	0.69
R9250:Olfr888	UTSW	9	38109422	nonsense	probably null
Z1088:Olfr888	UTSW	9	38109586	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCAGTGCCAACAAGCATGG -3'
(R):5'- GCCATTGCTGTCAAAATGTAGC -3'

Sequencing Primer
(F):5'- GCCAACAAGCATGGGATAACTTTTAC -3'
(R):5'- TGCTGTCAAAATGTAGCATTCATC -3'

Posted On

2015-04-02