Incidental Mutation 'R3824:Or8b1b'
ID 275287
Institutional Source Beutler Lab
Gene Symbol Or8b1b
Ensembl Gene ENSMUSG00000094380
Gene Name olfactory receptor family 8 subfamily B member 1B
Synonyms Olfr904, MOR167-3, GA_x6K02T2PVTD-32156773-32157705
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38375330-38378952 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38375822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 162 (C162S)
Ref Sequence ENSEMBL: ENSMUSP00000150057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058153] [ENSMUST00000216724]
AlphaFold Q7TRC9
Predicted Effect probably benign
Transcript: ENSMUST00000058153
AA Change: C162S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057148
Gene: ENSMUSG00000094380
AA Change: C162S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-51 PFAM
Pfam:7tm_1 41 291 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216724
AA Change: C162S

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Or8b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Or8b1b APN 9 38,376,030 (GRCm39) missense probably benign
IGL01966:Or8b1b APN 9 38,376,225 (GRCm39) missense possibly damaging 0.82
IGL02328:Or8b1b APN 9 38,375,972 (GRCm39) missense probably benign
IGL03394:Or8b1b APN 9 38,375,517 (GRCm39) missense probably damaging 1.00
R0085:Or8b1b UTSW 9 38,375,958 (GRCm39) missense probably benign 0.37
R0125:Or8b1b UTSW 9 38,375,757 (GRCm39) nonsense probably null
R1506:Or8b1b UTSW 9 38,375,439 (GRCm39) missense probably benign 0.02
R1545:Or8b1b UTSW 9 38,375,815 (GRCm39) missense probably benign 0.37
R1610:Or8b1b UTSW 9 38,375,927 (GRCm39) missense probably damaging 0.97
R2008:Or8b1b UTSW 9 38,375,537 (GRCm39) missense probably damaging 1.00
R2424:Or8b1b UTSW 9 38,376,128 (GRCm39) missense probably damaging 0.99
R3964:Or8b1b UTSW 9 38,375,979 (GRCm39) missense probably benign 0.25
R4093:Or8b1b UTSW 9 38,375,379 (GRCm39) missense probably null 1.00
R4454:Or8b1b UTSW 9 38,375,938 (GRCm39) missense probably benign 0.03
R5650:Or8b1b UTSW 9 38,376,023 (GRCm39) nonsense probably null
R6921:Or8b1b UTSW 9 38,375,543 (GRCm39) missense probably benign 0.01
R7406:Or8b1b UTSW 9 38,375,439 (GRCm39) missense possibly damaging 0.88
R7597:Or8b1b UTSW 9 38,375,802 (GRCm39) missense probably benign 0.01
R7959:Or8b1b UTSW 9 38,376,211 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATGTTTAACCCAGCTATATTTC -3'
(R):5'- TGGACCTGCCTTCATTGGAC -3'

Sequencing Primer
(F):5'- GTTTAACCCAGCTATATTTCTTCTGC -3'
(R):5'- GACCTGCCTTCATTGGACTTGATG -3'
Posted On 2015-04-02