Incidental Mutation 'R3824:Ptprb'
ID275289
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116350789 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1743 (I1743F)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: I1456F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: I1456F

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: I1743F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1383 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
R7833:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7834:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7846:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7896:Ptprb UTSW 10 116369457 splice site probably null
R7901:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7912:Ptprb UTSW 10 116322487 missense probably damaging 1.00
R7941:Ptprb UTSW 10 116283677 small deletion probably benign
R8147:Ptprb UTSW 10 116317378 missense probably damaging 1.00
R8202:Ptprb UTSW 10 116353845 missense probably damaging 1.00
R8339:Ptprb UTSW 10 116283451 missense probably benign 0.14
R8400:Ptprb UTSW 10 116283572 small deletion probably benign
R8504:Ptprb UTSW 10 116341031 missense probably benign 0.27
R8679:Ptprb UTSW 10 116367590 missense probably damaging 1.00
R8786:Ptprb UTSW 10 116319401 missense probably benign 0.40
R8914:Ptprb UTSW 10 116322662 nonsense probably null
R8980:Ptprb UTSW 10 116283621 missense probably benign 0.07
R8982:Ptprb UTSW 10 116283677 small deletion probably benign
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Z1176:Ptprb UTSW 10 116302156 frame shift probably null
Z1177:Ptprb UTSW 10 116362642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGACGCCCCTTTCATTATGC -3'
(R):5'- ACCTTGAAGAAGTCAGCTCTG -3'

Sequencing Primer
(F):5'- CATTATGCTTAATGTGCCACTGG -3'
(R):5'- AAGAAGTCAGCTCTGTGTCTTC -3'
Posted On2015-04-02