Incidental Mutation 'R3824:Myo19'
ID 275294
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Name myosin XIX
Synonyms Myohd1, 1110055A02Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84770996-84802052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84776505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 54 (C54S)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020837] [ENSMUST00000093969]
AlphaFold Q5SV80
Predicted Effect probably damaging
Transcript: ENSMUST00000020837
AA Change: C54S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020837
Gene: ENSMUSG00000020527
AA Change: C54S

DomainStartEndE-ValueType
MYSc 29 205 2.18e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093969
AA Change: C54S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: C54S

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Meta Mutation Damage Score 0.2751 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84,800,324 (GRCm39) missense probably benign 0.00
IGL01120:Myo19 APN 11 84,798,104 (GRCm39) missense probably damaging 0.96
IGL01542:Myo19 APN 11 84,800,372 (GRCm39) missense probably damaging 0.96
IGL02341:Myo19 APN 11 84,778,871 (GRCm39) splice site probably benign
IGL02708:Myo19 APN 11 84,790,222 (GRCm39) missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84,801,297 (GRCm39) missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84,791,046 (GRCm39) missense probably damaging 1.00
BB014:Myo19 UTSW 11 84,791,046 (GRCm39) missense probably damaging 1.00
R0009:Myo19 UTSW 11 84,778,995 (GRCm39) critical splice donor site probably null
R0125:Myo19 UTSW 11 84,779,001 (GRCm39) splice site probably benign
R0142:Myo19 UTSW 11 84,785,429 (GRCm39) missense probably damaging 1.00
R0226:Myo19 UTSW 11 84,788,558 (GRCm39) splice site probably benign
R0230:Myo19 UTSW 11 84,784,159 (GRCm39) missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84,800,245 (GRCm39) missense probably benign 0.00
R1981:Myo19 UTSW 11 84,782,996 (GRCm39) missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84,788,434 (GRCm39) missense probably benign
R2185:Myo19 UTSW 11 84,783,047 (GRCm39) missense probably benign 0.00
R3176:Myo19 UTSW 11 84,783,001 (GRCm39) missense probably benign 0.01
R3276:Myo19 UTSW 11 84,783,001 (GRCm39) missense probably benign 0.01
R3914:Myo19 UTSW 11 84,785,429 (GRCm39) missense probably damaging 1.00
R4333:Myo19 UTSW 11 84,799,114 (GRCm39) missense probably benign 0.00
R4335:Myo19 UTSW 11 84,799,114 (GRCm39) missense probably benign 0.00
R4647:Myo19 UTSW 11 84,785,468 (GRCm39) missense probably damaging 1.00
R4968:Myo19 UTSW 11 84,792,328 (GRCm39) missense probably damaging 1.00
R4971:Myo19 UTSW 11 84,783,023 (GRCm39) missense probably damaging 1.00
R5083:Myo19 UTSW 11 84,794,037 (GRCm39) missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84,776,098 (GRCm39) splice site probably null
R5558:Myo19 UTSW 11 84,801,274 (GRCm39) missense probably damaging 1.00
R5739:Myo19 UTSW 11 84,788,450 (GRCm39) missense probably damaging 1.00
R5982:Myo19 UTSW 11 84,790,226 (GRCm39) missense probably damaging 0.97
R6093:Myo19 UTSW 11 84,776,535 (GRCm39) missense probably damaging 1.00
R6444:Myo19 UTSW 11 84,786,134 (GRCm39) missense probably benign
R6657:Myo19 UTSW 11 84,788,022 (GRCm39) missense probably benign
R6945:Myo19 UTSW 11 84,788,386 (GRCm39) missense probably benign 0.06
R7022:Myo19 UTSW 11 84,791,373 (GRCm39) missense probably damaging 0.99
R7058:Myo19 UTSW 11 84,798,194 (GRCm39) missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84,796,439 (GRCm39) missense probably benign
R7155:Myo19 UTSW 11 84,791,412 (GRCm39) missense probably damaging 1.00
R7478:Myo19 UTSW 11 84,776,626 (GRCm39) missense probably benign 0.41
R7486:Myo19 UTSW 11 84,796,463 (GRCm39) missense probably benign
R7833:Myo19 UTSW 11 84,800,093 (GRCm39) missense probably benign
R7921:Myo19 UTSW 11 84,799,064 (GRCm39) missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84,776,536 (GRCm39) missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84,791,046 (GRCm39) missense probably damaging 1.00
R9105:Myo19 UTSW 11 84,794,029 (GRCm39) missense probably damaging 0.99
R9714:Myo19 UTSW 11 84,773,542 (GRCm39) start codon destroyed probably null 0.18
X0053:Myo19 UTSW 11 84,788,541 (GRCm39) nonsense probably null
Z1176:Myo19 UTSW 11 84,800,176 (GRCm39) frame shift probably null
Z1176:Myo19 UTSW 11 84,776,104 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAATTGAGACTCCTGACCTGG -3'
(R):5'- CCAATAGGGATGGAGAGTCTGC -3'

Sequencing Primer
(F):5'- ACTCCTGACCTGGCCTGTG -3'
(R):5'- TCTGCAGGGAGGGCCTTAC -3'
Posted On 2015-04-02