Incidental Mutation 'R3824:Coq6'
ID 275298
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Name coenzyme Q6 monooxygenase
Synonyms 5930427M12Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 84408530-84420570 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 84419189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000117286] [ENSMUST00000120942] [ENSMUST00000122194] [ENSMUST00000152913]
AlphaFold Q8R1S0
Predicted Effect probably benign
Transcript: ENSMUST00000021661
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021662
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072061
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110272
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117286
SMART Domains Protein: ENSMUSP00000114011
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120942
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122194
SMART Domains Protein: ENSMUSP00000113106
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84,414,913 (GRCm39) splice site probably benign
R0607:Coq6 UTSW 12 84,415,412 (GRCm39) missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84,418,301 (GRCm39) missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84,419,238 (GRCm39) missense probably damaging 1.00
R1898:Coq6 UTSW 12 84,413,737 (GRCm39) missense probably benign 0.38
R3153:Coq6 UTSW 12 84,418,309 (GRCm39) missense probably damaging 1.00
R4015:Coq6 UTSW 12 84,413,671 (GRCm39) missense probably benign 0.00
R4241:Coq6 UTSW 12 84,420,563 (GRCm39) utr 3 prime probably benign
R4285:Coq6 UTSW 12 84,417,178 (GRCm39) intron probably benign
R4353:Coq6 UTSW 12 84,414,923 (GRCm39) missense probably damaging 0.99
R4598:Coq6 UTSW 12 84,408,913 (GRCm39) missense probably benign 0.00
R4599:Coq6 UTSW 12 84,408,913 (GRCm39) missense probably benign 0.00
R4868:Coq6 UTSW 12 84,417,726 (GRCm39) missense probably damaging 0.99
R4887:Coq6 UTSW 12 84,419,070 (GRCm39) missense probably damaging 1.00
R5567:Coq6 UTSW 12 84,415,413 (GRCm39) missense probably benign 0.10
R5570:Coq6 UTSW 12 84,415,413 (GRCm39) missense probably benign 0.10
R5715:Coq6 UTSW 12 84,413,681 (GRCm39) missense probably benign 0.10
R6608:Coq6 UTSW 12 84,418,922 (GRCm39) missense probably benign 0.00
R7035:Coq6 UTSW 12 84,415,415 (GRCm39) missense probably damaging 0.99
R7096:Coq6 UTSW 12 84,408,595 (GRCm39) critical splice donor site probably null
R7851:Coq6 UTSW 12 84,418,929 (GRCm39) missense possibly damaging 0.57
R7908:Coq6 UTSW 12 84,417,940 (GRCm39) missense probably damaging 1.00
R9432:Coq6 UTSW 12 84,420,464 (GRCm39) missense probably benign 0.01
Z1176:Coq6 UTSW 12 84,417,737 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CAAGTATAGCCAAGGTGGATGC -3'
(R):5'- CTGTGGTTACAAAGCAAGAGC -3'

Sequencing Primer
(F):5'- GCTAAAAGCAGAGCCCTCTTTC -3'
(R):5'- TAAACCCTGATGGCAGTAGTAAC -3'
Posted On 2015-04-02