Incidental Mutation 'R3824:Col11a2'
ID 275305
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Name collagen, type XI, alpha 2
Synonyms
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R3824 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34258411-34285659 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34273154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 630 (Y630H)
Ref Sequence ENSEMBL: ENSMUSP00000084772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]
AlphaFold Q64739
Predicted Effect probably damaging
Transcript: ENSMUST00000087497
AA Change: Y630H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: Y630H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114252
AA Change: Y635H

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: Y635H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114255
AA Change: Y669H
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: Y669H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131134
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137374
Predicted Effect probably damaging
Transcript: ENSMUST00000143354
AA Change: Y322H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: Y322H

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173749
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34,280,254 (GRCm39) unclassified probably benign
IGL01839:Col11a2 APN 17 34,283,056 (GRCm39) unclassified probably benign
IGL02429:Col11a2 APN 17 34,261,266 (GRCm39) missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34,283,181 (GRCm39) unclassified probably benign
BB010:Col11a2 UTSW 17 34,275,029 (GRCm39) nonsense probably null
BB020:Col11a2 UTSW 17 34,275,029 (GRCm39) nonsense probably null
PIT4531001:Col11a2 UTSW 17 34,265,412 (GRCm39) critical splice acceptor site probably null
R0001:Col11a2 UTSW 17 34,280,586 (GRCm39) missense probably benign 0.00
R0005:Col11a2 UTSW 17 34,281,853 (GRCm39) unclassified probably benign
R0099:Col11a2 UTSW 17 34,268,648 (GRCm39) missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34,276,249 (GRCm39) missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34,281,520 (GRCm39) unclassified probably benign
R0254:Col11a2 UTSW 17 34,283,777 (GRCm39) unclassified probably benign
R0352:Col11a2 UTSW 17 34,261,501 (GRCm39) missense probably benign 0.43
R0362:Col11a2 UTSW 17 34,281,420 (GRCm39) splice site probably null
R0491:Col11a2 UTSW 17 34,261,186 (GRCm39) missense probably null 0.00
R0531:Col11a2 UTSW 17 34,277,351 (GRCm39) splice site probably benign
R0538:Col11a2 UTSW 17 34,270,302 (GRCm39) splice site probably benign
R0646:Col11a2 UTSW 17 34,278,322 (GRCm39) critical splice donor site probably null
R0676:Col11a2 UTSW 17 34,276,249 (GRCm39) missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34,278,124 (GRCm39) missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34,274,228 (GRCm39) missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34,282,869 (GRCm39) unclassified probably benign
R1872:Col11a2 UTSW 17 34,281,529 (GRCm39) unclassified probably benign
R1941:Col11a2 UTSW 17 34,263,925 (GRCm39) missense probably benign 0.01
R1945:Col11a2 UTSW 17 34,278,142 (GRCm39) missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34,271,143 (GRCm39) missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34,283,771 (GRCm39) unclassified probably benign
R2258:Col11a2 UTSW 17 34,258,651 (GRCm39) missense probably benign
R2259:Col11a2 UTSW 17 34,258,651 (GRCm39) missense probably benign
R2260:Col11a2 UTSW 17 34,258,651 (GRCm39) missense probably benign
R2761:Col11a2 UTSW 17 34,270,000 (GRCm39) missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34,265,442 (GRCm39) missense possibly damaging 0.69
R3938:Col11a2 UTSW 17 34,258,599 (GRCm39) unclassified probably benign
R4039:Col11a2 UTSW 17 34,264,748 (GRCm39) missense probably benign 0.00
R4675:Col11a2 UTSW 17 34,283,267 (GRCm39) critical splice donor site probably null
R4810:Col11a2 UTSW 17 34,276,086 (GRCm39) missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34,269,937 (GRCm39) missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34,261,164 (GRCm39) missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34,283,062 (GRCm39) unclassified probably benign
R5355:Col11a2 UTSW 17 34,270,775 (GRCm39) missense probably benign 0.07
R5384:Col11a2 UTSW 17 34,278,148 (GRCm39) critical splice donor site probably null
R5534:Col11a2 UTSW 17 34,269,998 (GRCm39) missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34,283,159 (GRCm39) unclassified probably benign
R6252:Col11a2 UTSW 17 34,261,186 (GRCm39) missense probably null 0.00
R6327:Col11a2 UTSW 17 34,262,291 (GRCm39) missense probably benign 0.32
R6828:Col11a2 UTSW 17 34,272,607 (GRCm39) splice site probably null
R6860:Col11a2 UTSW 17 34,272,572 (GRCm39) missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34,283,993 (GRCm39) missense unknown
R6992:Col11a2 UTSW 17 34,266,118 (GRCm39) missense probably benign 0.01
R7292:Col11a2 UTSW 17 34,270,482 (GRCm39) missense unknown
R7543:Col11a2 UTSW 17 34,269,430 (GRCm39) missense unknown
R7933:Col11a2 UTSW 17 34,275,029 (GRCm39) nonsense probably null
R8157:Col11a2 UTSW 17 34,280,230 (GRCm39) missense unknown
R8161:Col11a2 UTSW 17 34,270,264 (GRCm39) missense unknown
R8209:Col11a2 UTSW 17 34,266,253 (GRCm39) critical splice donor site probably null
R8493:Col11a2 UTSW 17 34,278,936 (GRCm39) missense possibly damaging 0.82
R8705:Col11a2 UTSW 17 34,268,769 (GRCm39) missense unknown
R8901:Col11a2 UTSW 17 34,262,254 (GRCm39) missense probably damaging 1.00
R8946:Col11a2 UTSW 17 34,270,757 (GRCm39) missense probably benign 0.40
R9010:Col11a2 UTSW 17 34,283,760 (GRCm39) missense unknown
R9108:Col11a2 UTSW 17 34,276,634 (GRCm39) missense probably benign 0.21
R9138:Col11a2 UTSW 17 34,279,847 (GRCm39) missense
R9147:Col11a2 UTSW 17 34,273,119 (GRCm39) splice site probably benign
R9148:Col11a2 UTSW 17 34,273,119 (GRCm39) splice site probably benign
R9338:Col11a2 UTSW 17 34,266,204 (GRCm39) missense unknown
R9485:Col11a2 UTSW 17 34,258,669 (GRCm39) missense unknown
X0017:Col11a2 UTSW 17 34,278,959 (GRCm39) critical splice donor site probably null
X0064:Col11a2 UTSW 17 34,261,221 (GRCm39) missense possibly damaging 0.88
Z1176:Col11a2 UTSW 17 34,275,376 (GRCm39) missense unknown
Z1177:Col11a2 UTSW 17 34,270,640 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTGAGGTGTCTTCAGACTGG -3'
(R):5'- GAACACAGCTTACCTTTTCACC -3'

Sequencing Primer
(F):5'- TGTCTTCAGACTGGGGAGCAC -3'
(R):5'- ACCCTTGTGGCCCTTCAGG -3'
Posted On 2015-04-02