Incidental Mutation 'R3824:Ptk7'
ID 275307
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene Name PTK7 protein tyrosine kinase 7
Synonyms 8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 46875397-46940430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46876304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1049 (I1049T)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
AlphaFold Q8BKG3
Predicted Effect probably damaging
Transcript: ENSMUST00000044442
AA Change: I1049T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: I1049T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.5553 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46,885,353 (GRCm39) missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46,884,492 (GRCm39) nonsense probably null
IGL01444:Ptk7 APN 17 46,876,313 (GRCm39) missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46,887,806 (GRCm39) missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46,883,474 (GRCm39) missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46,890,353 (GRCm39) missense probably benign 0.37
IGL02496:Ptk7 APN 17 46,901,070 (GRCm39) missense probably benign 0.04
IGL02864:Ptk7 APN 17 46,883,659 (GRCm39) missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46,883,688 (GRCm39) splice site probably benign
R0671:Ptk7 UTSW 17 46,901,238 (GRCm39) missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46,883,517 (GRCm39) missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46,883,517 (GRCm39) missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46,883,578 (GRCm39) missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46,884,460 (GRCm39) missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46,897,223 (GRCm39) missense probably benign 0.44
R1846:Ptk7 UTSW 17 46,887,416 (GRCm39) critical splice donor site probably null
R1973:Ptk7 UTSW 17 46,897,733 (GRCm39) nonsense probably null
R2060:Ptk7 UTSW 17 46,877,164 (GRCm39) missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46,890,543 (GRCm39) missense probably benign 0.09
R2472:Ptk7 UTSW 17 46,887,774 (GRCm39) missense probably benign 0.35
R2937:Ptk7 UTSW 17 46,883,476 (GRCm39) missense probably damaging 0.99
R3845:Ptk7 UTSW 17 46,897,344 (GRCm39) missense probably benign 0.00
R4222:Ptk7 UTSW 17 46,885,389 (GRCm39) missense probably benign
R4671:Ptk7 UTSW 17 46,885,392 (GRCm39) missense probably benign
R4922:Ptk7 UTSW 17 46,887,417 (GRCm39) critical splice donor site probably null
R5319:Ptk7 UTSW 17 46,883,603 (GRCm39) missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46,876,296 (GRCm39) missense probably benign
R6254:Ptk7 UTSW 17 46,883,568 (GRCm39) missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46,887,816 (GRCm39) missense probably benign 0.00
R6806:Ptk7 UTSW 17 46,884,454 (GRCm39) missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46,890,525 (GRCm39) missense probably benign 0.00
R7394:Ptk7 UTSW 17 46,902,683 (GRCm39) missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46,882,569 (GRCm39) missense possibly damaging 0.81
R7949:Ptk7 UTSW 17 46,897,387 (GRCm39) missense possibly damaging 0.64
R8773:Ptk7 UTSW 17 46,877,193 (GRCm39) missense possibly damaging 0.88
R9059:Ptk7 UTSW 17 46,877,117 (GRCm39) missense probably damaging 1.00
R9327:Ptk7 UTSW 17 46,878,977 (GRCm39) missense probably benign 0.17
R9495:Ptk7 UTSW 17 46,887,744 (GRCm39) missense possibly damaging 0.82
R9514:Ptk7 UTSW 17 46,887,744 (GRCm39) missense possibly damaging 0.82
R9638:Ptk7 UTSW 17 46,890,519 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGCCAGTCTTCAGCAATGC -3'
(R):5'- GTCCCTGAGAGAATACCATGG -3'

Sequencing Primer
(F):5'- CAATGCCTGCTGTGCTTG -3'
(R):5'- TCAATCCCCAGCAGGTATTG -3'
Posted On 2015-04-02