Mutagenetix > Incidental Mutations

Incidental Mutation 'R3824:Ptprm'

275308

Institutional Source

Beutler Lab

Gene Symbol

Ptprm

Ensembl Gene

ENSMUSG00000033278

Gene Name

protein tyrosine phosphatase, receptor type, M

Synonyms

RPTPmu

MMRRC Submission

040885-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3824 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66666947-67354457 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66809575 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 894 (V894A)

Ref Sequence

ENSEMBL: ENSMUSP00000153463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091]

Predicted Effect

probably benign
Transcript: ENSMUST00000037974
AA Change: V903A

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: V903A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
MAM	22	184	2.81e-73	SMART
IG	191	279	2.1e-6	SMART
FN3	281	364	6.35e-4	SMART
FN3	380	468	2.81e-5	SMART
FN3	482	572	3.7e-5	SMART
transmembrane domain	743	764	N/A	INTRINSIC
low complexity region	765	774	N/A	INTRINSIC
PTPc	899	1156	5.26e-135	SMART
PTPc	1185	1450	9.46e-96	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223982
AA Change: V869A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000224091
AA Change: V894A

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000225554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225688

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	C	17: 35,567,611	C20R	probably benign	Het
6030468B19Rik	A	G	11: 117,802,913	K69E	probably damaging	Het
9430015G10Rik	T	A	4: 156,119,150		probably null	Het
A2ml1	A	G	6: 128,568,763	V467A	probably damaging	Het
Abcc3	T	C	11: 94,368,620		probably null	Het
Acad10	A	T	5: 121,622,818	M941K	probably benign	Het
Agrn	A	G	4: 156,169,302	L1649P	probably damaging	Het
Arhgap12	T	C	18: 6,061,930	R402G	possibly damaging	Het
Atp4b	T	C	8: 13,393,549	Y43C	probably damaging	Het
Btn2a2	T	A	13: 23,480,465	T308S	probably benign	Het
C8b	G	T	4: 104,783,009	A170S	probably benign	Het
Cabyr	T	A	18: 12,751,690	D411E	probably benign	Het
Capn3	T	C	2: 120,484,483		probably benign	Het
Cd200r4	T	C	16: 44,820,950	F19L	probably benign	Het
Cflar	T	A	1: 58,735,697	Y218N	probably benign	Het
Col11a2	T	C	17: 34,054,180	Y630H	probably damaging	Het
Coq6	T	C	12: 84,372,415		probably benign	Het
Drg2	A	G	11: 60,459,508	T98A	possibly damaging	Het
Fam205c	A	G	4: 42,873,492		probably null	Het
Fry	T	A	5: 150,496,419	S1015R	possibly damaging	Het
Gjb4	A	G	4: 127,351,429	S240P	probably benign	Het
Glmp	G	A	3: 88,326,411	V107I	probably damaging	Het
Gls	A	C	1: 52,232,988	M2R	possibly damaging	Het
Gm13078	A	T	4: 143,726,685	H121L	probably benign	Het
Gm5724	T	C	6: 141,754,374	Q144R	possibly damaging	Het
Gm906	G	A	13: 50,245,512	S926F	possibly damaging	Het
Igfbp4	A	G	11: 99,048,235	E27G	probably damaging	Het
Ints8	A	T	4: 11,225,621	Y645*	probably null	Het
Kat6a	G	T	8: 22,862,364	V55F	probably damaging	Het
Kat8	T	A	7: 127,924,482	D292E	possibly damaging	Het
Myo19	T	A	11: 84,885,679	C54S	probably damaging	Het
Myo5b	C	T	18: 74,661,655	H532Y	probably benign	Het
Nckap1	T	C	2: 80,540,560	K357E	possibly damaging	Het
Ndufaf1	C	T	2: 119,660,271	V105M	probably benign	Het
Olfr1076	T	G	2: 86,509,023	L188R	possibly damaging	Het
Olfr1394	A	G	11: 49,160,793	S260G	possibly damaging	Het
Olfr888	A	T	9: 38,108,838	I51F	possibly damaging	Het
Olfr895	T	G	9: 38,268,518	S2A	probably benign	Het
Olfr904	T	A	9: 38,464,526	C162S	probably benign	Het
Palld	T	C	8: 61,709,033	D439G	probably damaging	Het
Pcf11	T	C	7: 92,659,620		probably benign	Het
Pigo	A	T	4: 43,020,909	W678R	possibly damaging	Het
Pip5kl1	A	T	2: 32,583,271		probably null	Het
Plscr3	G	A	11: 69,850,138	V267M	probably benign	Het
Prom2	A	G	2: 127,535,673		probably benign	Het
Ptk7	A	G	17: 46,565,378	I1049T	probably damaging	Het
Ptprb	A	T	10: 116,350,789	I1743F	probably benign	Het
Rack1	A	G	11: 48,802,304	T105A	probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Sdk1	A	G	5: 141,936,049	T267A	probably benign	Het
Sorcs3	T	A	19: 48,722,956	D653E	probably damaging	Het
St8sia1	A	G	6: 142,829,025	L276P	probably damaging	Het
Sync	T	C	4: 129,294,363	V396A	possibly damaging	Het
Taok3	A	G	5: 117,255,937	T592A	probably benign	Het
Tas2r104	T	A	6: 131,685,039	I236F	possibly damaging	Het
Tas2r107	A	C	6: 131,659,330	I252S	probably benign	Het
Tmem259	T	C	10: 79,978,448	N334S	possibly damaging	Het
Tsga10	A	T	1: 37,834,197	N200K	possibly damaging	Het
Usp24	G	A	4: 106,379,066	V984I	probably benign	Het
Vmn1r189	T	A	13: 22,102,212	T152S	probably benign	Het
Vmn1r2	A	T	4: 3,172,413	T111S	probably damaging	Het
Vmn2r74	T	G	7: 85,958,258	N86H	probably damaging	Het
Zfp12	T	C	5: 143,240,322	V72A	probably benign	Het

Other mutations in Ptprm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Ptprm	APN	17	66817972	missense	probably damaging	1.00
IGL01128:Ptprm	APN	17	67042101	missense	probably damaging	1.00
IGL01509:Ptprm	APN	17	66762213	missense	possibly damaging	0.95
IGL01785:Ptprm	APN	17	66685623	missense	probably damaging	1.00
IGL01912:Ptprm	APN	17	67046118	missense	probably benign	0.13
IGL01929:Ptprm	APN	17	66690549	missense	probably damaging	1.00
IGL01937:Ptprm	APN	17	67046163	splice site	probably benign
IGL01939:Ptprm	APN	17	67063163	splice site	probably benign
IGL02053:Ptprm	APN	17	66693841	missense	probably damaging	1.00
IGL02203:Ptprm	APN	17	66953123	missense	probably damaging	1.00
IGL02468:Ptprm	APN	17	66814509	missense	probably benign	0.02
IGL02500:Ptprm	APN	17	66920048	missense	probably damaging	0.99
IGL02542:Ptprm	APN	17	66920150	missense	probably benign
Becalming	UTSW	17	66944332	splice site	probably null
Pacifying	UTSW	17	66683408	missense	possibly damaging	0.74
R0674:Ptprm	UTSW	17	67191341	missense	possibly damaging	0.52
R0709:Ptprm	UTSW	17	66944332	splice site	probably null
R1054:Ptprm	UTSW	17	67042318	missense	probably damaging	1.00
R1522:Ptprm	UTSW	17	66693871	missense	possibly damaging	0.91
R1561:Ptprm	UTSW	17	66940541	missense	probably damaging	1.00
R1726:Ptprm	UTSW	17	67042327	missense	probably damaging	1.00
R1744:Ptprm	UTSW	17	66689366	missense	probably damaging	1.00
R1873:Ptprm	UTSW	17	66688355	missense	probably damaging	1.00
R1951:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1952:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1953:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1993:Ptprm	UTSW	17	66747160	missense	probably damaging	1.00
R2017:Ptprm	UTSW	17	66957153	splice site	probably null
R2266:Ptprm	UTSW	17	66725851	splice site	probably null
R2417:Ptprm	UTSW	17	66944326	missense	probably damaging	0.97
R2511:Ptprm	UTSW	17	66693778	missense	probably damaging	1.00
R3726:Ptprm	UTSW	17	66956860	missense	possibly damaging	0.91
R4057:Ptprm	UTSW	17	67075663	missense	possibly damaging	0.93
R4113:Ptprm	UTSW	17	66725813	missense	probably damaging	1.00
R4559:Ptprm	UTSW	17	66683408	missense	possibly damaging	0.74
R4598:Ptprm	UTSW	17	67095497	missense	probably benign	0.00
R4742:Ptprm	UTSW	17	66744751	nonsense	probably null
R4974:Ptprm	UTSW	17	66678067	missense	probably benign	0.01
R5157:Ptprm	UTSW	17	66957097	missense	probably benign	0.09
R5433:Ptprm	UTSW	17	66693473	missense	probably damaging	1.00
R5509:Ptprm	UTSW	17	66689358	missense	probably damaging	1.00
R5586:Ptprm	UTSW	17	66920196	missense	probably damaging	1.00
R5820:Ptprm	UTSW	17	66689465	missense	probably damaging	1.00
R5867:Ptprm	UTSW	17	67045981	splice site	probably null
R6044:Ptprm	UTSW	17	66693862	missense	probably damaging	1.00
R6229:Ptprm	UTSW	17	66688300	missense	probably damaging	1.00
R6615:Ptprm	UTSW	17	67353956	critical splice donor site	probably null
R6969:Ptprm	UTSW	17	66912418	missense	possibly damaging	0.63
R7135:Ptprm	UTSW	17	66944288	missense	possibly damaging	0.93
R7161:Ptprm	UTSW	17	66809627	missense	probably benign	0.21
R7410:Ptprm	UTSW	17	66693566	missense	probably damaging	0.99
R7476:Ptprm	UTSW	17	66725791	missense	probably benign	0.01
R7789:Ptprm	UTSW	17	67095539	missense	probably damaging	1.00
R8027:Ptprm	UTSW	17	66944205	missense	probably damaging	1.00
R8089:Ptprm	UTSW	17	66683488	missense	possibly damaging	0.63
R8442:Ptprm	UTSW	17	66944317	missense	possibly damaging	0.70
R8476:Ptprm	UTSW	17	66944322	missense	probably damaging	1.00
R8866:Ptprm	UTSW	17	66809635	missense	probably benign	0.00
R8907:Ptprm	UTSW	17	66744737	missense	probably damaging	0.99
R8930:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R8932:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R9009:Ptprm	UTSW	17	66689359	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACACGCAAACTTGGTCTAAG -3'
(R):5'- TCCTACAGTGGAGGGATGTC -3'

Sequencing Primer
(F):5'- CTCTGCCTGGCATCTCAAGG -3'
(R):5'- CTACAGTGGAGGGATGTCAGCAG -3'

Posted On

2015-04-02