Incidental Mutation 'R3824:Arhgap12'
ID275309
Institutional Source Beutler Lab
Gene Symbol Arhgap12
Ensembl Gene ENSMUSG00000041225
Gene NameRho GTPase activating protein 12
Synonyms2810011M08Rik
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6024427-6136098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6061930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 402 (R402G)
Ref Sequence ENSEMBL: ENSMUSP00000138585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062584] [ENSMUST00000077128] [ENSMUST00000182038] [ENSMUST00000182066] [ENSMUST00000182213] [ENSMUST00000182383] [ENSMUST00000182559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062584
AA Change: R355G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054209
Gene: ENSMUSG00000041225
AA Change: R355G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077128
AA Change: R402G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076376
Gene: ENSMUSG00000041225
AA Change: R402G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 431 544 9.56e-11 SMART
low complexity region 546 555 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
RhoGAP 634 808 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181989
Predicted Effect probably benign
Transcript: ENSMUST00000182038
SMART Domains Protein: ENSMUSP00000138150
Gene: ENSMUSG00000041225

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182066
AA Change: R355G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138496
Gene: ENSMUSG00000041225
AA Change: R355G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 409 522 9.56e-11 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
RhoGAP 612 786 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182178
Predicted Effect possibly damaging
Transcript: ENSMUST00000182213
AA Change: R402G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138464
Gene: ENSMUSG00000041225
AA Change: R402G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 461 574 9.56e-11 SMART
low complexity region 576 585 N/A INTRINSIC
low complexity region 593 607 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
RhoGAP 664 838 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182322
Predicted Effect possibly damaging
Transcript: ENSMUST00000182383
AA Change: R355G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138444
Gene: ENSMUSG00000041225
AA Change: R355G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 384 497 9.56e-11 SMART
low complexity region 499 508 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
RhoGAP 587 761 5.47e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182559
AA Change: R402G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138585
Gene: ENSMUSG00000041225
AA Change: R402G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182614
Predicted Effect probably benign
Transcript: ENSMUST00000182921
Meta Mutation Damage Score 0.1727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: A null gene trap mutation resulted in no notable phenotype in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr1394 A G 11: 49,160,793 S260G possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Arhgap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Arhgap12 APN 18 6057576 missense probably benign 0.01
IGL01652:Arhgap12 APN 18 6061853 missense possibly damaging 0.89
IGL01886:Arhgap12 APN 18 6027613 missense probably damaging 1.00
IGL02716:Arhgap12 APN 18 6111857 missense possibly damaging 0.95
IGL03195:Arhgap12 APN 18 6031766 missense probably damaging 1.00
IGL03134:Arhgap12 UTSW 18 6111936 missense probably benign 0.22
R0312:Arhgap12 UTSW 18 6061982 intron probably benign
R0330:Arhgap12 UTSW 18 6039382 missense probably damaging 1.00
R0600:Arhgap12 UTSW 18 6064433 intron probably benign
R0891:Arhgap12 UTSW 18 6026699 missense probably damaging 1.00
R1123:Arhgap12 UTSW 18 6031822 missense probably damaging 1.00
R1395:Arhgap12 UTSW 18 6037058 missense probably benign 0.20
R1644:Arhgap12 UTSW 18 6112340 missense probably benign 0.00
R2968:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R2970:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R3809:Arhgap12 UTSW 18 6037057 missense probably benign 0.36
R4181:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4182:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4183:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4497:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R4498:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R5456:Arhgap12 UTSW 18 6112170 nonsense probably null
R5539:Arhgap12 UTSW 18 6111932 missense probably benign 0.00
R5915:Arhgap12 UTSW 18 6037016 critical splice donor site probably null
R6859:Arhgap12 UTSW 18 6111803 missense probably damaging 1.00
R6960:Arhgap12 UTSW 18 6111901 missense probably damaging 1.00
R7114:Arhgap12 UTSW 18 6028056 missense probably damaging 1.00
R7285:Arhgap12 UTSW 18 6111920 missense probably damaging 1.00
R7359:Arhgap12 UTSW 18 6065709 missense possibly damaging 0.92
R8048:Arhgap12 UTSW 18 6052883 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGCCAACATTATTTTGTACTTGCTC -3'
(R):5'- CTGCTCAGGAAGAAGGCTGAC -3'

Sequencing Primer
(F):5'- TTCCCAAGCACTTGCCA -3'
(R):5'- CTGACATGAGACAGCTCTTGG -3'
Posted On2015-04-02