Incidental Mutation 'R3824:Arhgap12'
ID 275309
Institutional Source Beutler Lab
Gene Symbol Arhgap12
Ensembl Gene ENSMUSG00000041225
Gene Name Rho GTPase activating protein 12
Synonyms 2810011M08Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 6024448-6136102 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6061930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 402 (R402G)
Ref Sequence ENSEMBL: ENSMUSP00000138585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062584] [ENSMUST00000077128] [ENSMUST00000182038] [ENSMUST00000182066] [ENSMUST00000182213] [ENSMUST00000182383] [ENSMUST00000182559]
AlphaFold Q8C0D4
Predicted Effect possibly damaging
Transcript: ENSMUST00000062584
AA Change: R355G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054209
Gene: ENSMUSG00000041225
AA Change: R355G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077128
AA Change: R402G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076376
Gene: ENSMUSG00000041225
AA Change: R402G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 431 544 9.56e-11 SMART
low complexity region 546 555 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
RhoGAP 634 808 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181989
Predicted Effect probably benign
Transcript: ENSMUST00000182038
SMART Domains Protein: ENSMUSP00000138150
Gene: ENSMUSG00000041225

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182066
AA Change: R355G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138496
Gene: ENSMUSG00000041225
AA Change: R355G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 409 522 9.56e-11 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
RhoGAP 612 786 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182178
Predicted Effect possibly damaging
Transcript: ENSMUST00000182213
AA Change: R402G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138464
Gene: ENSMUSG00000041225
AA Change: R402G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 461 574 9.56e-11 SMART
low complexity region 576 585 N/A INTRINSIC
low complexity region 593 607 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
RhoGAP 664 838 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182322
Predicted Effect possibly damaging
Transcript: ENSMUST00000182383
AA Change: R355G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138444
Gene: ENSMUSG00000041225
AA Change: R355G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 384 497 9.56e-11 SMART
low complexity region 499 508 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
RhoGAP 587 761 5.47e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182559
AA Change: R402G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138585
Gene: ENSMUSG00000041225
AA Change: R402G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182614
Predicted Effect probably benign
Transcript: ENSMUST00000182921
Meta Mutation Damage Score 0.1727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: A null gene trap mutation resulted in no notable phenotype in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Sorcs3 T A 19: 48,711,395 (GRCm39) D653E probably damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Arhgap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Arhgap12 APN 18 6,057,576 (GRCm39) missense probably benign 0.01
IGL01652:Arhgap12 APN 18 6,061,853 (GRCm39) missense possibly damaging 0.89
IGL01886:Arhgap12 APN 18 6,027,613 (GRCm39) missense probably damaging 1.00
IGL02716:Arhgap12 APN 18 6,111,857 (GRCm39) missense possibly damaging 0.95
IGL03195:Arhgap12 APN 18 6,031,766 (GRCm39) missense probably damaging 1.00
eelier UTSW 18 6,061,930 (GRCm39) missense possibly damaging 0.80
eerie UTSW 18 6,111,734 (GRCm39) missense probably damaging 1.00
IGL03134:Arhgap12 UTSW 18 6,111,936 (GRCm39) missense probably benign 0.22
R0312:Arhgap12 UTSW 18 6,061,982 (GRCm39) intron probably benign
R0330:Arhgap12 UTSW 18 6,039,382 (GRCm39) missense probably damaging 1.00
R0600:Arhgap12 UTSW 18 6,064,433 (GRCm39) intron probably benign
R0891:Arhgap12 UTSW 18 6,026,699 (GRCm39) missense probably damaging 1.00
R1123:Arhgap12 UTSW 18 6,031,822 (GRCm39) missense probably damaging 1.00
R1395:Arhgap12 UTSW 18 6,037,058 (GRCm39) missense probably benign 0.20
R1644:Arhgap12 UTSW 18 6,112,340 (GRCm39) missense probably benign 0.00
R2968:Arhgap12 UTSW 18 6,111,732 (GRCm39) missense probably damaging 1.00
R2970:Arhgap12 UTSW 18 6,111,732 (GRCm39) missense probably damaging 1.00
R3809:Arhgap12 UTSW 18 6,037,057 (GRCm39) missense probably benign 0.36
R4181:Arhgap12 UTSW 18 6,111,734 (GRCm39) missense probably damaging 1.00
R4182:Arhgap12 UTSW 18 6,111,734 (GRCm39) missense probably damaging 1.00
R4183:Arhgap12 UTSW 18 6,111,734 (GRCm39) missense probably damaging 1.00
R4497:Arhgap12 UTSW 18 6,111,774 (GRCm39) missense probably damaging 1.00
R4498:Arhgap12 UTSW 18 6,111,774 (GRCm39) missense probably damaging 1.00
R5456:Arhgap12 UTSW 18 6,112,170 (GRCm39) nonsense probably null
R5539:Arhgap12 UTSW 18 6,111,932 (GRCm39) missense probably benign 0.00
R5915:Arhgap12 UTSW 18 6,037,016 (GRCm39) critical splice donor site probably null
R6859:Arhgap12 UTSW 18 6,111,803 (GRCm39) missense probably damaging 1.00
R6960:Arhgap12 UTSW 18 6,111,901 (GRCm39) missense probably damaging 1.00
R7114:Arhgap12 UTSW 18 6,028,056 (GRCm39) missense probably damaging 1.00
R7285:Arhgap12 UTSW 18 6,111,920 (GRCm39) missense probably damaging 1.00
R7359:Arhgap12 UTSW 18 6,065,709 (GRCm39) missense possibly damaging 0.92
R8048:Arhgap12 UTSW 18 6,052,883 (GRCm39) missense probably benign 0.02
R8249:Arhgap12 UTSW 18 6,027,635 (GRCm39) missense probably damaging 1.00
R8523:Arhgap12 UTSW 18 6,111,976 (GRCm39) missense probably benign 0.12
R9110:Arhgap12 UTSW 18 6,034,539 (GRCm39) missense possibly damaging 0.94
R9444:Arhgap12 UTSW 18 6,052,909 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGCCAACATTATTTTGTACTTGCTC -3'
(R):5'- CTGCTCAGGAAGAAGGCTGAC -3'

Sequencing Primer
(F):5'- TTCCCAAGCACTTGCCA -3'
(R):5'- CTGACATGAGACAGCTCTTGG -3'
Posted On 2015-04-02