Incidental Mutation 'R3824:Sorcs3'
ID 275312
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 040885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R3824 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48711395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 653 (D653E)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably damaging
Transcript: ENSMUST00000078880
AA Change: D653E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: D653E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,508 (GRCm39) C20R probably benign Het
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
9430015G10Rik T A 4: 156,203,607 (GRCm39) probably null Het
A2ml1 A G 6: 128,545,726 (GRCm39) V467A probably damaging Het
Abcc3 T C 11: 94,259,446 (GRCm39) probably null Het
Acad10 A T 5: 121,760,881 (GRCm39) M941K probably benign Het
Agrn A G 4: 156,253,759 (GRCm39) L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 (GRCm39) R402G possibly damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Btn2a2 T A 13: 23,664,635 (GRCm39) T308S probably benign Het
C8b G T 4: 104,640,206 (GRCm39) A170S probably benign Het
Cabyr T A 18: 12,884,747 (GRCm39) D411E probably benign Het
Capn3 T C 2: 120,314,964 (GRCm39) probably benign Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Cflar T A 1: 58,774,856 (GRCm39) Y218N probably benign Het
Col11a2 T C 17: 34,273,154 (GRCm39) Y630H probably damaging Het
Coq6 T C 12: 84,419,189 (GRCm39) probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fry T A 5: 150,419,884 (GRCm39) S1015R possibly damaging Het
Gjb4 A G 4: 127,245,222 (GRCm39) S240P probably benign Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gls A C 1: 52,272,147 (GRCm39) M2R possibly damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Ints8 A T 4: 11,225,621 (GRCm39) Y645* probably null Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kat8 T A 7: 127,523,654 (GRCm39) D292E possibly damaging Het
Myo19 T A 11: 84,776,505 (GRCm39) C54S probably damaging Het
Myo5b C T 18: 74,794,726 (GRCm39) H532Y probably benign Het
Nckap1 T C 2: 80,370,904 (GRCm39) K357E possibly damaging Het
Ndufaf1 C T 2: 119,490,752 (GRCm39) V105M probably benign Het
Or2o1 A G 11: 49,051,620 (GRCm39) S260G possibly damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8b1b T A 9: 38,375,822 (GRCm39) C162S probably benign Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Or8k30 T G 2: 86,339,367 (GRCm39) L188R possibly damaging Het
Palld T C 8: 62,162,067 (GRCm39) D439G probably damaging Het
Pcf11 T C 7: 92,308,828 (GRCm39) probably benign Het
Pigo A T 4: 43,020,909 (GRCm39) W678R possibly damaging Het
Pip5kl1 A T 2: 32,473,283 (GRCm39) probably null Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Pramel24 A T 4: 143,453,255 (GRCm39) H121L probably benign Het
Prom2 A G 2: 127,377,593 (GRCm39) probably benign Het
Ptk7 A G 17: 46,876,304 (GRCm39) I1049T probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Ptprm A G 17: 67,116,570 (GRCm39) V894A probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Sdk1 A G 5: 141,921,804 (GRCm39) T267A probably benign Het
Slco1a7 T C 6: 141,700,100 (GRCm39) Q144R possibly damaging Het
Spata31e3 G A 13: 50,399,548 (GRCm39) S926F possibly damaging Het
Spata31f3 A G 4: 42,873,492 (GRCm39) probably null Het
St8sia1 A G 6: 142,774,751 (GRCm39) L276P probably damaging Het
Sync T C 4: 129,188,156 (GRCm39) V396A possibly damaging Het
Taok3 A G 5: 117,394,002 (GRCm39) T592A probably benign Het
Tas2r104 T A 6: 131,662,002 (GRCm39) I236F possibly damaging Het
Tas2r107 A C 6: 131,636,293 (GRCm39) I252S probably benign Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Usp24 G A 4: 106,236,263 (GRCm39) V984I probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 (GRCm39) T111S probably damaging Het
Vmn2r74 T G 7: 85,607,466 (GRCm39) N86H probably damaging Het
Zfp12 T C 5: 143,226,077 (GRCm39) V72A probably benign Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCTGCGAAGAGAAATTTTGATC -3'
(R):5'- AATTAGGGCTCGAGTTCCTG -3'

Sequencing Primer
(F):5'- CTGCGAAGAGAAATTTTGATCAAATC -3'
(R):5'- AGTTCCTGTGATTCTGTCAGTAGCTC -3'
Posted On 2015-04-02