Incidental Mutation 'R3825:Tsga10'
ID275314
Institutional Source Beutler Lab
Gene Symbol Tsga10
Ensembl Gene ENSMUSG00000060771
Gene Nametestis specific 10
Synonyms4933432N21Rik, Mtsga10
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37754776-37866429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37834197 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 200 (N200K)
Ref Sequence ENSEMBL: ENSMUSP00000120554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041815] [ENSMUST00000088072] [ENSMUST00000114902] [ENSMUST00000123082] [ENSMUST00000151735] [ENSMUST00000155852] [ENSMUST00000193669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041815
AA Change: N200K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048859
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000088072
AA Change: N200K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085391
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114902
AA Change: N200K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110552
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123082
SMART Domains Protein: ENSMUSP00000141261
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151735
AA Change: N200K

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120554
Gene: ENSMUSG00000060771
AA Change: N200K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155852
SMART Domains Protein: ENSMUSP00000141630
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193669
SMART Domains Protein: ENSMUSP00000142218
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Tsga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tsga10 APN 1 37807070 missense probably damaging 0.99
IGL00579:Tsga10 APN 1 37835453 missense probably damaging 1.00
IGL00837:Tsga10 APN 1 37801911 splice site probably benign
IGL01577:Tsga10 APN 1 37835457 missense possibly damaging 0.85
IGL01727:Tsga10 APN 1 37835274 missense probably damaging 1.00
IGL02037:Tsga10 APN 1 37807017 missense probably benign 0.05
IGL02510:Tsga10 APN 1 37760985 missense possibly damaging 0.89
R0346:Tsga10 UTSW 1 37840519 missense possibly damaging 0.65
R0789:Tsga10 UTSW 1 37801787 missense possibly damaging 0.87
R0961:Tsga10 UTSW 1 37761428 critical splice donor site probably null
R1370:Tsga10 UTSW 1 37835453 missense probably damaging 1.00
R1440:Tsga10 UTSW 1 37819599 missense probably damaging 1.00
R1827:Tsga10 UTSW 1 37835580 missense probably damaging 1.00
R2504:Tsga10 UTSW 1 37815677 missense probably damaging 1.00
R3104:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3105:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3106:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3824:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R4560:Tsga10 UTSW 1 37807082 missense probably benign 0.00
R4773:Tsga10 UTSW 1 37835525 missense probably damaging 1.00
R4927:Tsga10 UTSW 1 37801850 missense probably damaging 1.00
R5036:Tsga10 UTSW 1 37783968 missense possibly damaging 0.65
R5326:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5345:Tsga10 UTSW 1 37763311 missense probably damaging 1.00
R5503:Tsga10 UTSW 1 37760947 makesense probably null
R5542:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5793:Tsga10 UTSW 1 37835459 missense probably damaging 1.00
R6340:Tsga10 UTSW 1 37835185 intron probably benign
R7096:Tsga10 UTSW 1 37840614 missense probably damaging 0.98
R7130:Tsga10 UTSW 1 37783884 missense probably damaging 1.00
R7401:Tsga10 UTSW 1 37834187 missense probably null 1.00
R7609:Tsga10 UTSW 1 37804893 intron probably null
R7649:Tsga10 UTSW 1 37835148 missense unknown
R7773:Tsga10 UTSW 1 37835242 missense unknown
R8242:Tsga10 UTSW 1 37807101 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCTCAGTTTTCAGAGGGCTG -3'
(R):5'- AGGCTGCACACTGATGGTAG -3'

Sequencing Primer
(F):5'- CAGTTTTCAGAGGGCTGTATAAAAAC -3'
(R):5'- CTGCACACTGATGGTAGCTAACTG -3'
Posted On2015-04-02