Incidental Mutation 'R3825:Fmo1'
ID275317
Institutional Source Beutler Lab
Gene Symbol Fmo1
Ensembl Gene ENSMUSG00000040181
Gene Nameflavin containing monooxygenase 1
Synonyms
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162829561-162866610 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 162851347 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046049] [ENSMUST00000111518] [ENSMUST00000131058] [ENSMUST00000134098] [ENSMUST00000193078]
Predicted Effect probably benign
Transcript: ENSMUST00000046049
SMART Domains Protein: ENSMUSP00000037259
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 1.5e-279 PFAM
Pfam:Pyr_redox_2 3 228 3.8e-13 PFAM
Pfam:NAD_binding_8 7 63 8e-7 PFAM
Pfam:K_oxygenase 73 226 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111518
SMART Domains Protein: ENSMUSP00000107143
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 170 4.6e-93 PFAM
Pfam:Pyr_redox_3 6 173 2.7e-8 PFAM
Pfam:NAD_binding_8 7 65 5.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131058
SMART Domains Protein: ENSMUSP00000118534
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 209 9.3e-122 PFAM
Pfam:Pyr_redox_2 4 208 8.2e-9 PFAM
Pfam:Pyr_redox_3 6 209 7.5e-16 PFAM
Pfam:NAD_binding_8 7 65 5.2e-8 PFAM
Pfam:K_oxygenase 72 209 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134098
SMART Domains Protein: ENSMUSP00000117398
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 303 1.4e-168 PFAM
Pfam:Pyr_redox_2 4 280 8e-9 PFAM
Pfam:Pyr_redox_3 6 220 5.5e-16 PFAM
Pfam:NAD_binding_8 7 65 9.5e-8 PFAM
Pfam:K_oxygenase 72 224 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193078
SMART Domains Protein: ENSMUSP00000141210
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 230 9.4e-132 PFAM
Pfam:Pyr_redox_2 4 223 4.9e-7 PFAM
Pfam:Pyr_redox_3 6 220 3.1e-14 PFAM
Pfam:NAD_binding_8 7 65 6.9e-6 PFAM
Pfam:K_oxygenase 72 222 3.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Fmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Fmo1 APN 1 162836246 missense probably damaging 1.00
IGL00479:Fmo1 APN 1 162830063 missense probably benign 0.00
IGL01612:Fmo1 APN 1 162833599 missense probably benign 0.42
IGL01650:Fmo1 APN 1 162833584 missense probably benign 0.04
IGL02052:Fmo1 APN 1 162850060 critical splice donor site probably null
IGL02340:Fmo1 APN 1 162832990 missense probably benign 0.02
IGL03348:Fmo1 APN 1 162850151 missense possibly damaging 0.76
IGL03388:Fmo1 APN 1 162836147 missense probably benign 0.17
PIT1430001:Fmo1 UTSW 1 162830053 missense probably benign 0.00
R0279:Fmo1 UTSW 1 162830272 missense possibly damaging 0.92
R0314:Fmo1 UTSW 1 162859462 missense probably damaging 1.00
R0348:Fmo1 UTSW 1 162836135 missense probably benign 0.00
R0385:Fmo1 UTSW 1 162836204 missense possibly damaging 0.94
R0699:Fmo1 UTSW 1 162833772 missense probably benign 0.00
R1413:Fmo1 UTSW 1 162833862 missense probably damaging 0.98
R1424:Fmo1 UTSW 1 162830066 missense probably damaging 1.00
R1430:Fmo1 UTSW 1 162839724 missense probably damaging 1.00
R1851:Fmo1 UTSW 1 162829985 nonsense probably null
R1929:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R1982:Fmo1 UTSW 1 162839756 missense possibly damaging 0.83
R2272:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R2568:Fmo1 UTSW 1 162836259 missense probably benign 0.00
R3787:Fmo1 UTSW 1 162830014 missense possibly damaging 0.54
R3904:Fmo1 UTSW 1 162833768 missense possibly damaging 0.54
R4320:Fmo1 UTSW 1 162833631 missense probably damaging 1.00
R4367:Fmo1 UTSW 1 162833648 nonsense probably null
R4431:Fmo1 UTSW 1 162833712 missense possibly damaging 0.76
R4473:Fmo1 UTSW 1 162850163 missense possibly damaging 0.90
R5340:Fmo1 UTSW 1 162829982 missense probably benign 0.39
R5354:Fmo1 UTSW 1 162830145 missense probably benign 0.01
R5479:Fmo1 UTSW 1 162850224 missense probably damaging 0.99
R5930:Fmo1 UTSW 1 162839616 critical splice donor site probably null
R6148:Fmo1 UTSW 1 162851519 missense probably damaging 0.99
R6160:Fmo1 UTSW 1 162836298 missense probably benign 0.00
R6164:Fmo1 UTSW 1 162851410 missense probably benign 0.24
R6263:Fmo1 UTSW 1 162850060 critical splice donor site probably null
R7046:Fmo1 UTSW 1 162839694 missense possibly damaging 0.92
R7590:Fmo1 UTSW 1 162859682 intron probably benign
R7663:Fmo1 UTSW 1 162836297 missense possibly damaging 0.74
R7692:Fmo1 UTSW 1 162833833 missense probably benign 0.16
R7712:Fmo1 UTSW 1 162836135 missense probably benign 0.00
R8207:Fmo1 UTSW 1 162850107 missense probably benign 0.28
X0022:Fmo1 UTSW 1 162830000 missense possibly damaging 0.57
X0066:Fmo1 UTSW 1 162839704 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTGCCCACTAACCAGGAGG -3'
(R):5'- GCCAGTCTTTACAAGTCTGTGG -3'

Sequencing Primer
(F):5'- AAATCAGAGAAGTTGGGTTTCTTAGG -3'
(R):5'- CAAGTCTGTGGTTTCTAACAGCAGC -3'
Posted On2015-04-02