Incidental Mutation 'R3825:Ss18l1'
ID275321
Institutional Source Beutler Lab
Gene Symbol Ss18l1
Ensembl Gene ENSMUSG00000039086
Gene NameSS18, nBAF chromatin remodeling complex subunit like 1
SynonymsCREST, A230053O16Rik
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180042509-180070201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 180063310 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 365 (Q365L)
Ref Sequence ENSEMBL: ENSMUSP00000041288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041126]
Predicted Effect unknown
Transcript: ENSMUST00000041126
AA Change: Q365L
SMART Domains Protein: ENSMUSP00000041288
Gene: ENSMUSG00000039086
AA Change: Q365L

DomainStartEndE-ValueType
Pfam:SSXT 13 74 4.3e-35 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 215 238 N/A INTRINSIC
low complexity region 244 251 N/A INTRINSIC
low complexity region 311 375 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
Meta Mutation Damage Score 0.1641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have central nervous system and coordination defects. They grow slowly and usually die before adulthood. Those that do survive are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Ss18l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0781:Ss18l1 UTSW 2 180055854 missense possibly damaging 0.57
R0904:Ss18l1 UTSW 2 180059354 missense probably damaging 1.00
R1938:Ss18l1 UTSW 2 180063345 missense unknown
R2853:Ss18l1 UTSW 2 180058121 missense probably damaging 1.00
R4907:Ss18l1 UTSW 2 180063399 critical splice donor site probably null
R5256:Ss18l1 UTSW 2 180061942 missense unknown
R5508:Ss18l1 UTSW 2 180057653 missense probably damaging 0.96
R6216:Ss18l1 UTSW 2 180061913 missense unknown
R6218:Ss18l1 UTSW 2 180055112 missense probably benign 0.00
R7529:Ss18l1 UTSW 2 180058157 missense possibly damaging 0.80
R8192:Ss18l1 UTSW 2 180059362 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCCTTCAGTGCTCCATATC -3'
(R):5'- AGTCCCACTTGTTCTTCAGGAC -3'

Sequencing Primer
(F):5'- GCTCCATATCTGTGTGGGCAC -3'
(R):5'- CCACTTGTTCTTCAGGACAGTAAGAG -3'
Posted On2015-04-02