Incidental Mutation 'R3825:Mab21l2'
ID275323
Institutional Source Beutler Lab
Gene Symbol Mab21l2
Ensembl Gene ENSMUSG00000057777
Gene Namemab-21-like 2 (C. elegans)
Synonyms
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86545581-86548629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86546904 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 263 (E263G)
Ref Sequence ENSEMBL: ENSMUSP00000076729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077524] [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524] [ENSMUST00000212390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077524
AA Change: E263G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076729
Gene: ENSMUSG00000057777
AA Change: E263G

DomainStartEndE-ValueType
Mab-21 61 347 1.61e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107635
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191695
Predicted Effect probably benign
Transcript: ENSMUST00000192145
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194674
Predicted Effect probably benign
Transcript: ENSMUST00000194759
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195398
Predicted Effect probably benign
Transcript: ENSMUST00000195524
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212390
Meta Mutation Damage Score 0.1401 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the C. elegans MAB-21 cell fate-determining gene, a downstream target of transforming growth factor-beta signaling. It is thought that this gene may be involved in neural development. The protein encoded by this gene is primarily nuclear, although some cytoplasmic localization has been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in omphalocele and defects in ventral body wall formation resulting in death at mid-gestation. Mutants have impaired development of the retina and lens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Mab21l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Mab21l2 APN 3 86546817 missense possibly damaging 0.67
IGL02143:Mab21l2 APN 3 86547255 missense possibly damaging 0.85
IGL02570:Mab21l2 APN 3 86547224 missense possibly damaging 0.79
R0401:Mab21l2 UTSW 3 86546989 missense probably benign 0.00
R1744:Mab21l2 UTSW 3 86546904 missense possibly damaging 0.58
R2088:Mab21l2 UTSW 3 86547009 missense probably damaging 1.00
R2504:Mab21l2 UTSW 3 86547555 missense probably damaging 1.00
R4361:Mab21l2 UTSW 3 86547190 missense probably damaging 1.00
R4664:Mab21l2 UTSW 3 86547504 missense probably benign
R5245:Mab21l2 UTSW 3 86547492 missense possibly damaging 0.52
R5791:Mab21l2 UTSW 3 86546737 missense probably damaging 1.00
R5878:Mab21l2 UTSW 3 86546718 missense probably damaging 1.00
R6187:Mab21l2 UTSW 3 86547258 missense probably damaging 1.00
R6880:Mab21l2 UTSW 3 86547156 missense possibly damaging 0.71
R7021:Mab21l2 UTSW 3 86547486 missense probably benign 0.01
R8095:Mab21l2 UTSW 3 86547462 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATCTCCAGGTCTGCTTGGC -3'
(R):5'- CGAAGGGTTCAACTTGCTCTCC -3'

Sequencing Primer
(F):5'- CTTACCCTGGAAGAGGTCGAG -3'
(R):5'- TCTCCAAGGAGTGCTACTCG -3'
Posted On2015-04-02