Incidental Mutation 'R3825:Dbndd1'
ID275341
Institutional Source Beutler Lab
Gene Symbol Dbndd1
Ensembl Gene ENSMUSG00000031970
Gene Namedysbindin (dystrobrevin binding protein 1) domain containing 1
SynonymsD8Ertd590e, 2810427I04Rik
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123504718-123515463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123509992 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 75 (I75F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127664] [ENSMUST00000176155] [ENSMUST00000176286] [ENSMUST00000177240]
Predicted Effect probably damaging
Transcript: ENSMUST00000074879
AA Change: I75F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074420
Gene: ENSMUSG00000031970
AA Change: I75F

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:Dysbindin 79 216 3.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176155
AA Change: I46F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135524
Gene: ENSMUSG00000031970
AA Change: I46F

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 189 3.6e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176286
AA Change: I46F

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134757
Gene: ENSMUSG00000031970
AA Change: I46F

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 96 3.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177240
AA Change: I46F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135216
Gene: ENSMUSG00000031970
AA Change: I46F

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 101 4.5e-10 PFAM
Pfam:Dysbindin 96 142 2.7e-14 PFAM
Meta Mutation Damage Score 0.0809 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Dbndd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0333:Dbndd1 UTSW 8 123506773 missense probably damaging 1.00
R3949:Dbndd1 UTSW 8 123506734 missense probably benign 0.19
R5361:Dbndd1 UTSW 8 123506745 missense probably damaging 1.00
R5396:Dbndd1 UTSW 8 123509843 missense probably damaging 1.00
R5795:Dbndd1 UTSW 8 123509880 missense probably damaging 0.98
R7184:Dbndd1 UTSW 8 123509121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCATTCTACAGACAGG -3'
(R):5'- CATCCACTGGCAGACACCTTTG -3'

Sequencing Primer
(F):5'- TCATACGCAGGCTGCTGGATG -3'
(R):5'- TGGCAGACACCTTTGCCCAG -3'
Posted On2015-04-02