Incidental Mutation 'R3825:Bsn'
ID 275345
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission 040774-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R3825 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107973221-108067583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107984055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3333 (D3333G)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: D3333G
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: D3333G

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124763
AA Change: D561G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198370
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,693,739 (GRCm39) K69E probably damaging Het
Abcb5 C T 12: 118,865,087 (GRCm39) probably null Het
Acot1 G T 12: 84,061,194 (GRCm39) G167* probably null Het
Agbl1 C T 7: 76,069,715 (GRCm39) H164Y probably damaging Het
Atp4b T C 8: 13,443,549 (GRCm39) Y43C probably damaging Het
Ccdc27 A C 4: 154,120,742 (GRCm39) D351E unknown Het
Cd200r4 T C 16: 44,641,313 (GRCm39) F19L probably benign Het
Dbndd1 T A 8: 124,236,731 (GRCm39) I75F probably damaging Het
Dennd5b T C 6: 148,946,334 (GRCm39) K426E probably benign Het
Drg2 A G 11: 60,350,334 (GRCm39) T98A possibly damaging Het
Fabp3 C T 4: 130,206,245 (GRCm39) probably null Het
Fmo1 T C 1: 162,678,916 (GRCm39) probably benign Het
Foxn2 A T 17: 88,791,837 (GRCm39) I236F probably damaging Het
Glmp G A 3: 88,233,718 (GRCm39) V107I probably damaging Het
Gpr15 A G 16: 58,538,723 (GRCm39) F122S probably damaging Het
Gvin-ps3 T C 7: 105,682,780 (GRCm39) I158M possibly damaging Het
Hmcn1 A T 1: 150,462,716 (GRCm39) D5140E probably benign Het
Hspa1a C T 17: 35,190,703 (GRCm39) V67M probably damaging Het
Igfbp4 A G 11: 98,939,061 (GRCm39) E27G probably damaging Het
Il7 A G 3: 7,642,226 (GRCm39) probably benign Het
Kat6a G T 8: 23,352,380 (GRCm39) V55F probably damaging Het
Kynu A G 2: 43,571,451 (GRCm39) T456A probably benign Het
Lcorl A G 5: 45,932,729 (GRCm39) probably benign Het
Lrp5 G A 19: 3,655,290 (GRCm39) R1077* probably null Het
Mab21l2 T C 3: 86,454,211 (GRCm39) E263G possibly damaging Het
Macf1 T A 4: 123,338,744 (GRCm39) D1436V probably benign Het
Map4k2 C A 19: 6,394,081 (GRCm39) T252N probably benign Het
Mterf2 A T 10: 84,956,147 (GRCm39) L159Q probably damaging Het
Muc5ac C A 7: 141,368,460 (GRCm39) T3063K possibly damaging Het
Myo18a T A 11: 77,668,292 (GRCm39) S51T possibly damaging Het
Ncoa3 G T 2: 165,896,718 (GRCm39) G503V possibly damaging Het
Ncor1 A T 11: 62,264,183 (GRCm39) H406Q probably benign Het
Nectin2 T C 7: 19,458,510 (GRCm39) K434E possibly damaging Het
Nipal2 A T 15: 34,578,852 (GRCm39) probably null Het
Nub1 G C 5: 24,912,851 (GRCm39) S517T probably benign Het
Or10a4 T C 7: 106,696,816 (GRCm39) L48P possibly damaging Het
Or4d10c A G 19: 12,065,391 (GRCm39) V255A probably damaging Het
Or8b101 A T 9: 38,020,134 (GRCm39) I51F possibly damaging Het
Or8c17 T G 9: 38,179,814 (GRCm39) S2A probably benign Het
Plscr3 G A 11: 69,740,964 (GRCm39) V267M probably benign Het
Plxnb2 G T 15: 89,050,602 (GRCm39) N451K probably benign Het
Ppp2r2a A G 14: 67,259,892 (GRCm39) L268P probably damaging Het
Ptprb A T 10: 116,186,694 (GRCm39) I1743F probably benign Het
Rack1 A G 11: 48,693,131 (GRCm39) T105A probably benign Het
Rhot1 G A 11: 80,116,907 (GRCm39) V94I probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Smc6 T A 12: 11,351,517 (GRCm39) probably benign Het
Spink8 T A 9: 109,645,861 (GRCm39) V11D probably damaging Het
Ss18l1 A T 2: 179,705,103 (GRCm39) Q365L unknown Het
Tbc1d31 T A 15: 57,779,474 (GRCm39) H62Q probably benign Het
Tbc1d9b T C 11: 50,061,954 (GRCm39) V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 (GRCm39) probably benign Het
Tmem220 G A 11: 66,916,077 (GRCm39) A25T possibly damaging Het
Tmem259 T C 10: 79,814,282 (GRCm39) N334S possibly damaging Het
Tmod3 A T 9: 75,414,809 (GRCm39) probably benign Het
Tmprss2 A T 16: 97,398,021 (GRCm39) Y52N probably damaging Het
Tsga10 A T 1: 37,873,278 (GRCm39) N200K possibly damaging Het
Ube2frt T C 12: 36,141,036 (GRCm39) probably benign Het
Vmn1r189 T A 13: 22,286,382 (GRCm39) T152S probably benign Het
Vmn2r76 C T 7: 85,880,415 (GRCm39) M90I probably benign Het
Zfr C T 15: 12,166,277 (GRCm39) A849V probably damaging Het
Znhit6 T C 3: 145,284,099 (GRCm39) M95T probably benign Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 107,992,309 (GRCm39) missense probably benign 0.01
IGL00330:Bsn APN 9 107,992,539 (GRCm39) missense probably damaging 1.00
IGL00863:Bsn APN 9 107,992,521 (GRCm39) missense probably damaging 1.00
IGL01123:Bsn APN 9 107,993,185 (GRCm39) missense probably damaging 1.00
IGL01330:Bsn APN 9 107,988,112 (GRCm39) unclassified probably benign
IGL01336:Bsn APN 9 107,988,984 (GRCm39) missense probably damaging 0.99
IGL01399:Bsn APN 9 107,984,386 (GRCm39) missense unknown
IGL01683:Bsn APN 9 107,992,095 (GRCm39) missense possibly damaging 0.71
IGL02022:Bsn APN 9 107,987,617 (GRCm39) unclassified probably benign
IGL02396:Bsn APN 9 107,993,245 (GRCm39) missense possibly damaging 0.90
IGL02538:Bsn APN 9 107,982,435 (GRCm39) missense unknown
IGL02565:Bsn APN 9 107,990,487 (GRCm39) missense probably damaging 0.99
IGL02661:Bsn APN 9 107,984,135 (GRCm39) nonsense probably null
IGL02739:Bsn APN 9 107,989,745 (GRCm39) missense probably benign 0.14
IGL02951:Bsn APN 9 107,992,812 (GRCm39) missense probably damaging 1.00
IGL02987:Bsn APN 9 108,003,503 (GRCm39) missense probably benign 0.03
IGL03033:Bsn APN 9 107,993,192 (GRCm39) missense probably damaging 1.00
IGL03069:Bsn APN 9 107,991,462 (GRCm39) missense probably damaging 1.00
IGL03076:Bsn APN 9 107,982,581 (GRCm39) missense unknown
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0167:Bsn UTSW 9 108,003,185 (GRCm39) missense probably benign 0.01
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0359:Bsn UTSW 9 107,989,045 (GRCm39) missense possibly damaging 0.81
R0514:Bsn UTSW 9 108,002,981 (GRCm39) missense probably benign 0.07
R0593:Bsn UTSW 9 107,987,505 (GRCm39) missense unknown
R0617:Bsn UTSW 9 107,984,439 (GRCm39) missense unknown
R0636:Bsn UTSW 9 107,985,033 (GRCm39) missense unknown
R0652:Bsn UTSW 9 107,982,941 (GRCm39) missense unknown
R0718:Bsn UTSW 9 107,988,559 (GRCm39) unclassified probably benign
R0730:Bsn UTSW 9 107,984,011 (GRCm39) missense unknown
R0905:Bsn UTSW 9 107,982,834 (GRCm39) missense unknown
R0963:Bsn UTSW 9 107,989,006 (GRCm39) missense possibly damaging 0.81
R0992:Bsn UTSW 9 107,991,553 (GRCm39) nonsense probably null
R1101:Bsn UTSW 9 107,993,610 (GRCm39) missense probably damaging 1.00
R1393:Bsn UTSW 9 107,987,716 (GRCm39) unclassified probably benign
R1490:Bsn UTSW 9 107,991,193 (GRCm39) missense probably benign 0.03
R1566:Bsn UTSW 9 108,003,184 (GRCm39) missense probably benign 0.35
R1582:Bsn UTSW 9 107,982,291 (GRCm39) missense unknown
R1738:Bsn UTSW 9 107,984,133 (GRCm39) missense unknown
R1867:Bsn UTSW 9 107,983,918 (GRCm39) missense unknown
R1918:Bsn UTSW 9 107,984,772 (GRCm39) missense unknown
R1933:Bsn UTSW 9 107,993,643 (GRCm39) missense possibly damaging 0.91
R1946:Bsn UTSW 9 107,991,850 (GRCm39) missense probably damaging 0.99
R1978:Bsn UTSW 9 107,991,748 (GRCm39) missense probably benign 0.35
R2068:Bsn UTSW 9 108,003,749 (GRCm39) missense possibly damaging 0.95
R2068:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R2113:Bsn UTSW 9 107,992,085 (GRCm39) missense probably benign 0.14
R2136:Bsn UTSW 9 107,990,430 (GRCm39) missense probably damaging 1.00
R2172:Bsn UTSW 9 107,987,191 (GRCm39) intron probably benign
R2266:Bsn UTSW 9 107,992,323 (GRCm39) missense probably damaging 1.00
R2293:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2294:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2368:Bsn UTSW 9 107,988,229 (GRCm39) nonsense probably null
R2442:Bsn UTSW 9 107,984,119 (GRCm39) missense unknown
R2507:Bsn UTSW 9 107,993,313 (GRCm39) missense probably damaging 1.00
R2880:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2881:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2922:Bsn UTSW 9 107,992,668 (GRCm39) missense probably damaging 1.00
R2922:Bsn UTSW 9 107,985,385 (GRCm39) missense unknown
R3618:Bsn UTSW 9 107,994,760 (GRCm39) critical splice acceptor site probably null
R3742:Bsn UTSW 9 107,982,938 (GRCm39) missense unknown
R3982:Bsn UTSW 9 107,984,365 (GRCm39) missense unknown
R4094:Bsn UTSW 9 107,991,069 (GRCm39) missense probably damaging 1.00
R4158:Bsn UTSW 9 107,990,145 (GRCm39) missense possibly damaging 0.95
R4225:Bsn UTSW 9 107,983,932 (GRCm39) missense unknown
R4261:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R4482:Bsn UTSW 9 107,991,863 (GRCm39) missense probably damaging 1.00
R4515:Bsn UTSW 9 107,981,277 (GRCm39) splice site probably null
R4585:Bsn UTSW 9 107,987,662 (GRCm39) unclassified probably benign
R4628:Bsn UTSW 9 107,990,434 (GRCm39) missense probably damaging 1.00
R4636:Bsn UTSW 9 107,992,623 (GRCm39) missense probably damaging 1.00
R4679:Bsn UTSW 9 107,987,329 (GRCm39) missense unknown
R4723:Bsn UTSW 9 107,989,854 (GRCm39) missense probably benign 0.03
R4843:Bsn UTSW 9 107,984,388 (GRCm39) missense unknown
R4885:Bsn UTSW 9 107,984,726 (GRCm39) nonsense probably null
R4936:Bsn UTSW 9 107,988,960 (GRCm39) missense probably damaging 1.00
R4942:Bsn UTSW 9 107,983,678 (GRCm39) missense unknown
R4972:Bsn UTSW 9 107,992,377 (GRCm39) missense probably damaging 1.00
R4992:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R5067:Bsn UTSW 9 107,989,152 (GRCm39) missense probably damaging 1.00
R5206:Bsn UTSW 9 107,982,572 (GRCm39) missense unknown
R5286:Bsn UTSW 9 107,988,123 (GRCm39) unclassified probably benign
R5492:Bsn UTSW 9 107,989,714 (GRCm39) missense probably damaging 0.98
R5553:Bsn UTSW 9 107,987,620 (GRCm39) unclassified probably benign
R5561:Bsn UTSW 9 107,982,710 (GRCm39) missense unknown
R5597:Bsn UTSW 9 107,992,131 (GRCm39) missense probably benign 0.06
R5646:Bsn UTSW 9 107,987,631 (GRCm39) unclassified probably benign
R5796:Bsn UTSW 9 108,003,223 (GRCm39) missense probably damaging 1.00
R5801:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5802:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5850:Bsn UTSW 9 107,992,149 (GRCm39) missense probably damaging 0.99
R5938:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R6221:Bsn UTSW 9 107,982,765 (GRCm39) missense unknown
R6243:Bsn UTSW 9 107,984,760 (GRCm39) missense unknown
R6254:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.96
R6263:Bsn UTSW 9 107,990,453 (GRCm39) missense probably damaging 1.00
R6345:Bsn UTSW 9 107,984,554 (GRCm39) missense unknown
R6368:Bsn UTSW 9 107,988,513 (GRCm39) unclassified probably benign
R6574:Bsn UTSW 9 107,991,153 (GRCm39) missense possibly damaging 0.95
R6793:Bsn UTSW 9 107,991,814 (GRCm39) nonsense probably null
R6802:Bsn UTSW 9 107,987,823 (GRCm39) unclassified probably benign
R6943:Bsn UTSW 9 107,985,016 (GRCm39) missense unknown
R6999:Bsn UTSW 9 107,990,632 (GRCm39) missense probably benign 0.00
R7149:Bsn UTSW 9 107,993,520 (GRCm39) nonsense probably null
R7199:Bsn UTSW 9 107,992,533 (GRCm39) missense probably damaging 1.00
R7322:Bsn UTSW 9 108,003,620 (GRCm39) nonsense probably null
R7349:Bsn UTSW 9 107,987,982 (GRCm39) missense unknown
R7372:Bsn UTSW 9 107,987,718 (GRCm39) missense unknown
R7373:Bsn UTSW 9 107,990,683 (GRCm39) missense probably damaging 1.00
R7413:Bsn UTSW 9 108,016,690 (GRCm39) missense possibly damaging 0.61
R7473:Bsn UTSW 9 107,989,449 (GRCm39) missense probably damaging 1.00
R7482:Bsn UTSW 9 107,990,728 (GRCm39) missense probably damaging 0.98
R7530:Bsn UTSW 9 107,989,155 (GRCm39) missense probably damaging 1.00
R7549:Bsn UTSW 9 107,992,014 (GRCm39) missense probably benign 0.05
R7570:Bsn UTSW 9 107,990,742 (GRCm39) missense probably damaging 1.00
R7635:Bsn UTSW 9 107,988,189 (GRCm39) missense unknown
R7696:Bsn UTSW 9 107,991,700 (GRCm39) missense probably damaging 1.00
R7757:Bsn UTSW 9 107,991,939 (GRCm39) missense possibly damaging 0.90
R7868:Bsn UTSW 9 107,992,098 (GRCm39) missense possibly damaging 0.95
R7897:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.98
R7960:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R8022:Bsn UTSW 9 107,991,603 (GRCm39) missense probably benign 0.01
R8056:Bsn UTSW 9 107,982,506 (GRCm39) missense
R8158:Bsn UTSW 9 107,987,232 (GRCm39) missense unknown
R8161:Bsn UTSW 9 108,016,729 (GRCm39) missense probably benign 0.20
R8225:Bsn UTSW 9 107,984,305 (GRCm39) missense
R8282:Bsn UTSW 9 107,984,890 (GRCm39) missense possibly damaging 0.73
R8296:Bsn UTSW 9 107,994,578 (GRCm39) missense probably benign 0.00
R8415:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8417:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8426:Bsn UTSW 9 108,003,772 (GRCm39) missense probably damaging 1.00
R8437:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8438:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8439:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8440:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8441:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8442:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8513:Bsn UTSW 9 107,991,709 (GRCm39) missense possibly damaging 0.65
R8529:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8535:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8546:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8548:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8549:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8682:Bsn UTSW 9 107,983,368 (GRCm39) missense
R8773:Bsn UTSW 9 107,987,704 (GRCm39) missense unknown
R8883:Bsn UTSW 9 107,990,227 (GRCm39) missense probably damaging 0.98
R8906:Bsn UTSW 9 107,984,752 (GRCm39) missense unknown
R9018:Bsn UTSW 9 107,994,488 (GRCm39) missense probably benign 0.06
R9070:Bsn UTSW 9 107,987,295 (GRCm39) missense
R9094:Bsn UTSW 9 107,988,052 (GRCm39) missense unknown
R9098:Bsn UTSW 9 107,990,173 (GRCm39) missense possibly damaging 0.65
R9128:Bsn UTSW 9 107,993,349 (GRCm39) missense probably benign 0.21
R9162:Bsn UTSW 9 107,987,883 (GRCm39) missense unknown
R9224:Bsn UTSW 9 107,982,686 (GRCm39) missense
R9230:Bsn UTSW 9 107,989,459 (GRCm39) missense probably damaging 1.00
R9233:Bsn UTSW 9 107,994,289 (GRCm39) missense probably benign 0.28
R9245:Bsn UTSW 9 107,993,292 (GRCm39) missense probably damaging 1.00
R9275:Bsn UTSW 9 107,988,819 (GRCm39) missense probably damaging 1.00
R9307:Bsn UTSW 9 107,992,993 (GRCm39) missense probably benign 0.01
R9343:Bsn UTSW 9 107,992,701 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,993,361 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,990,800 (GRCm39) missense probably damaging 1.00
R9378:Bsn UTSW 9 107,984,854 (GRCm39) missense possibly damaging 0.85
R9408:Bsn UTSW 9 108,016,652 (GRCm39) nonsense probably null
R9455:Bsn UTSW 9 107,988,531 (GRCm39) missense unknown
R9563:Bsn UTSW 9 107,984,616 (GRCm39) missense
R9615:Bsn UTSW 9 107,984,430 (GRCm39) missense
R9656:Bsn UTSW 9 107,994,407 (GRCm39) missense probably benign 0.09
R9698:Bsn UTSW 9 107,993,170 (GRCm39) missense probably damaging 1.00
X0028:Bsn UTSW 9 107,990,703 (GRCm39) missense probably damaging 1.00
X0066:Bsn UTSW 9 108,016,409 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 108,016,394 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 107,982,698 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGCCCATAGGTGATTTCATCC -3'
(R):5'- GATCGACGACATCAGCGAAC -3'

Sequencing Primer
(F):5'- CCATAGGTGATTTCATCCTGGAAC -3'
(R):5'- GAACTGACGAAGGACAGCACC -3'
Posted On 2015-04-02