Incidental Mutation 'R3825:Myo18a'
ID275355
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Namemyosin XVIIIA
SynonymsMyoPDZ
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77763246-77865980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77777466 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 51 (S51T)
Ref Sequence ENSEMBL: ENSMUSP00000130696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092887] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130627] [ENSMUST00000164315] [ENSMUST00000168348] [ENSMUST00000169105]
Predicted Effect probably benign
Transcript: ENSMUST00000000645
AA Change: S51T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092887
AA Change: S51T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100795
Predicted Effect possibly damaging
Transcript: ENSMUST00000102488
AA Change: S51T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108375
AA Change: S51T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108376
AA Change: S51T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130627
AA Change: S51T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164315
Predicted Effect possibly damaging
Transcript: ENSMUST00000168348
AA Change: S51T

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169105
AA Change: S51T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631
AA Change: S51T

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77847938 missense probably damaging 1.00
IGL00753:Myo18a APN 11 77825151 missense probably damaging 1.00
IGL01137:Myo18a APN 11 77827829 missense probably damaging 1.00
IGL01536:Myo18a APN 11 77820851 missense probably damaging 1.00
IGL01642:Myo18a APN 11 77864732 missense probably benign 0.07
IGL01728:Myo18a APN 11 77777856 missense probably damaging 0.99
IGL01780:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02286:Myo18a APN 11 77777985 nonsense probably null
IGL02350:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02357:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02420:Myo18a APN 11 77818693 missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77778172 missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77857852 splice site probably benign
IGL02869:Myo18a APN 11 77864786 missense probably damaging 1.00
IGL02869:Myo18a APN 11 77829873 splice site probably benign
IGL02962:Myo18a APN 11 77778235 missense probably damaging 1.00
IGL02963:Myo18a APN 11 77842018 splice site probably benign
IGL03410:Myo18a APN 11 77848004 missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77818770 missense probably benign 0.00
R0022:Myo18a UTSW 11 77843233 critical splice donor site probably null
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0098:Myo18a UTSW 11 77845765 missense probably damaging 1.00
R0322:Myo18a UTSW 11 77829800 missense probably damaging 1.00
R0373:Myo18a UTSW 11 77821042 missense probably benign 0.01
R0379:Myo18a UTSW 11 77850806 missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77811594 intron probably benign
R0688:Myo18a UTSW 11 77824140 missense probably damaging 1.00
R0734:Myo18a UTSW 11 77847404 missense probably damaging 1.00
R0790:Myo18a UTSW 11 77840709 missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77818901 splice site probably null
R1103:Myo18a UTSW 11 77823330 missense probably damaging 1.00
R1183:Myo18a UTSW 11 77857745 missense probably damaging 1.00
R1216:Myo18a UTSW 11 77818647 missense probably benign 0.35
R1331:Myo18a UTSW 11 77841579 missense probably benign 0.28
R1479:Myo18a UTSW 11 77842194 missense probably benign 0.04
R1723:Myo18a UTSW 11 77853314 missense probably damaging 0.97
R1742:Myo18a UTSW 11 77841467 missense probably damaging 0.99
R1796:Myo18a UTSW 11 77829344 missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77825097 splice site probably benign
R1827:Myo18a UTSW 11 77818771 missense probably benign 0.00
R2033:Myo18a UTSW 11 77843099 splice site probably null
R2043:Myo18a UTSW 11 77823363 missense probably damaging 0.99
R2105:Myo18a UTSW 11 77850234 missense probably benign
R2191:Myo18a UTSW 11 77818615 missense probably damaging 0.99
R2264:Myo18a UTSW 11 77819972 splice site probably benign
R2370:Myo18a UTSW 11 77777770 missense probably benign 0.03
R3015:Myo18a UTSW 11 77859020 intron probably benign
R3433:Myo18a UTSW 11 77818044 intron probably null
R3739:Myo18a UTSW 11 77845615 missense probably damaging 1.00
R4056:Myo18a UTSW 11 77812013 missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77829708 missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77857787 missense probably damaging 1.00
R4620:Myo18a UTSW 11 77817947 missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77824136 missense probably damaging 1.00
R4647:Myo18a UTSW 11 77817950 missense probably damaging 1.00
R4701:Myo18a UTSW 11 77817665 missense probably damaging 1.00
R4729:Myo18a UTSW 11 77777685 unclassified probably null
R4731:Myo18a UTSW 11 77829759 missense probably benign 0.00
R4739:Myo18a UTSW 11 77823323 missense probably damaging 1.00
R4814:Myo18a UTSW 11 77859236 intron probably benign
R4889:Myo18a UTSW 11 77832412 missense probably damaging 1.00
R4988:Myo18a UTSW 11 77845521 critical splice donor site probably null
R5172:Myo18a UTSW 11 77824098 missense probably damaging 1.00
R5177:Myo18a UTSW 11 77864842 utr 3 prime probably benign
R5394:Myo18a UTSW 11 77853350 missense probably benign 0.14
R5643:Myo18a UTSW 11 77854687 missense probably benign 0.12
R5808:Myo18a UTSW 11 77829301 missense probably benign 0.34
R5871:Myo18a UTSW 11 77832480 missense probably damaging 1.00
R5936:Myo18a UTSW 11 77818213 missense probably damaging 1.00
R6017:Myo18a UTSW 11 77841523 missense probably damaging 0.96
R6053:Myo18a UTSW 11 77818176 missense probably damaging 1.00
R6271:Myo18a UTSW 11 77820809 missense probably damaging 1.00
R6486:Myo18a UTSW 11 77864822 missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77850852 missense probably damaging 0.99
R6884:Myo18a UTSW 11 77819049 missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77845515 missense probably benign 0.06
R6993:Myo18a UTSW 11 77859074 intron probably benign
R7071:Myo18a UTSW 11 77823827 missense probably damaging 1.00
R7074:Myo18a UTSW 11 77842561 missense probably benign 0.03
R7238:Myo18a UTSW 11 77842233 missense probably damaging 0.96
R7328:Myo18a UTSW 11 77807911 missense
R7527:Myo18a UTSW 11 77843580 missense probably benign 0.00
R7598:Myo18a UTSW 11 77847346 missense probably damaging 1.00
R7671:Myo18a UTSW 11 77859420 missense
R8098:Myo18a UTSW 11 77845401 missense probably damaging 0.97
Y5407:Myo18a UTSW 11 77777815 missense probably benign 0.44
Z1177:Myo18a UTSW 11 77841995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAAGGTGGGGTCCAAAG -3'
(R):5'- TGAGGTCATCACTGGAGCTG -3'

Sequencing Primer
(F):5'- CACTCATAGTCAGCTGGGGATAC -3'
(R):5'- CATCACTGGAGCTGGCTGTG -3'
Posted On2015-04-02