Incidental Mutation 'R3825:Rhot1'
ID275356
Institutional Source Beutler Lab
Gene Symbol Rhot1
Ensembl Gene ENSMUSG00000017686
Gene Nameras homolog family member T1
Synonyms2210403N23Rik, Arht1, C430039G08Rik, FLJ11040, Miro1
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80209019-80267907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80226081 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 94 (V94I)
Ref Sequence ENSEMBL: ENSMUSP00000090533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017831] [ENSMUST00000055056] [ENSMUST00000077451] [ENSMUST00000092857]
Predicted Effect probably damaging
Transcript: ENSMUST00000017831
AA Change: V94I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017831
Gene: ENSMUSG00000017686
AA Change: V94I

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.5e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.6e-16 PFAM
Pfam:Ras 433 566 1.7e-6 PFAM
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055056
AA Change: V94I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057669
Gene: ENSMUSG00000017686
AA Change: V94I

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.6e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.4e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.7e-16 PFAM
Pfam:Ras 433 577 1.6e-6 PFAM
transmembrane domain 647 669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077451
AA Change: V94I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076664
Gene: ENSMUSG00000017686
AA Change: V94I

DomainStartEndE-ValueType
Pfam:Roc 19 135 9.4e-11 PFAM
Pfam:Ras 19 181 9.1e-21 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 232 318 8.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 354 426 7e-32 PFAM
Pfam:Ras 433 566 1.5e-6 PFAM
transmembrane domain 679 701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092857
AA Change: V94I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090533
Gene: ENSMUSG00000017686
AA Change: V94I

DomainStartEndE-ValueType
small_GTPase 15 182 5.1e-8 SMART
EFh 201 229 3.3e-2 SMART
Pfam:EF_assoc_2 231 319 2.9e-33 PFAM
EFh 321 349 8.1e-3 SMART
Pfam:EF_assoc_1 353 427 1e-30 PFAM
Pfam:Miro 433 543 8e-15 PFAM
Pfam:Ras 433 566 2.5e-5 PFAM
transmembrane domain 606 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154362
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele die neonatally exhibiting cyanosis, respiratory failure, loss of brainstem cranial motor neurons, decreased cervical motor neuron number and phrenic nerve branching, and alterations in retrograde mitochondrial transport and run length in cortical axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Rhot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Rhot1 APN 11 80226102 missense probably benign 0.27
IGL01335:Rhot1 APN 11 80250229 missense probably damaging 1.00
IGL01631:Rhot1 APN 11 80265774 missense probably damaging 1.00
IGL03009:Rhot1 APN 11 80220254 splice site probably null
IGL03106:Rhot1 APN 11 80242581 nonsense probably null
R0554:Rhot1 UTSW 11 80243438 nonsense probably null
R0720:Rhot1 UTSW 11 80223943 missense probably damaging 1.00
R1319:Rhot1 UTSW 11 80246021 missense probably damaging 0.98
R4713:Rhot1 UTSW 11 80225602 missense probably benign 0.00
R4917:Rhot1 UTSW 11 80209201 utr 5 prime probably benign
R4971:Rhot1 UTSW 11 80233474 missense probably damaging 1.00
R5159:Rhot1 UTSW 11 80220272 missense probably damaging 1.00
R5177:Rhot1 UTSW 11 80246766 missense possibly damaging 0.90
R5231:Rhot1 UTSW 11 80227334 critical splice donor site probably null
R5659:Rhot1 UTSW 11 80250355 intron probably null
R5941:Rhot1 UTSW 11 80251170 intron probably benign
R6216:Rhot1 UTSW 11 80251059 missense probably benign 0.00
R6920:Rhot1 UTSW 11 80242095 missense probably benign 0.36
R6984:Rhot1 UTSW 11 80233484 nonsense probably null
R7199:Rhot1 UTSW 11 80246734 missense probably damaging 1.00
R7383:Rhot1 UTSW 11 80223934 missense probably damaging 1.00
R7453:Rhot1 UTSW 11 80248540 critical splice donor site probably null
R7996:Rhot1 UTSW 11 80257537 missense probably damaging 1.00
R8116:Rhot1 UTSW 11 80251053 missense probably benign 0.00
Z1176:Rhot1 UTSW 11 80242621 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGAATTTCTCAATTGGTACTTG -3'
(R):5'- TGTGGGCTAGGATACAGAGC -3'

Sequencing Primer
(F):5'- CAGAAAATTTCCCCCTTTGG -3'
(R):5'- ACTCTGTGAGTTCAAGGCTAGAC -3'
Posted On2015-04-02