Incidental Mutation 'R3825:Smc6'
ID275360
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 11301516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000218022]
Predicted Effect probably benign
Transcript: ENSMUST00000020931
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184262
Predicted Effect probably benign
Transcript: ENSMUST00000217930
Predicted Effect probably benign
Transcript: ENSMUST00000217991
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218319
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11309300 missense probably damaging 1.00
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
R7477:Smc6 UTSW 12 11271807 missense probably benign
R7698:Smc6 UTSW 12 11283140 missense possibly damaging 0.92
R7832:Smc6 UTSW 12 11317843 missense probably benign 0.28
R7863:Smc6 UTSW 12 11289129 missense probably benign 0.00
R8192:Smc6 UTSW 12 11299335 missense probably benign 0.01
R8229:Smc6 UTSW 12 11291672 missense probably benign 0.25
R8289:Smc6 UTSW 12 11274051 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCACTAGGGAGGGGTAGAGTTC -3'
(R):5'- TGTCATTCCATAAGATACTGTTCACTG -3'

Sequencing Primer
(F):5'- GTGCTAACAACTGGCTGTAACTGC -3'
(R):5'- ACTGTTCACTGTTATAATGCTCATAC -3'
Posted On2015-04-02