Incidental Mutation 'R3825:Map4k2'
ID275378
Institutional Source Beutler Lab
Gene Symbol Map4k2
Ensembl Gene ENSMUSG00000024948
Gene Namemitogen-activated protein kinase kinase kinase kinase 2
SynonymsRab8ip, BL44
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6341135-6355615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6344051 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 252 (T252N)
Ref Sequence ENSEMBL: ENSMUSP00000120123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349] [ENSMUST00000166909]
Predicted Effect probably benign
Transcript: ENSMUST00000025897
AA Change: T296N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948
AA Change: T296N

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056391
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078137
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079327
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113500
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113501
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113502
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113503
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113504
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124333
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127809
Predicted Effect probably benign
Transcript: ENSMUST00000128170
SMART Domains Protein: ENSMUSP00000121856
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:CNH 2 142 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130382
AA Change: T252N

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948
AA Change: T252N

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137095
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152259
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156154
Predicted Effect probably benign
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170292
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184812
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Nub1 G C 5: 24,707,853 S517T probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Map4k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Map4k2 APN 19 6345593 unclassified probably null
IGL02041:Map4k2 APN 19 6351318 missense probably benign 0.45
IGL03372:Map4k2 APN 19 6342249 unclassified probably benign
IGL03380:Map4k2 APN 19 6344590 missense possibly damaging 0.83
R0968:Map4k2 UTSW 19 6345457 missense probably damaging 0.98
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1466:Map4k2 UTSW 19 6341917 missense probably damaging 1.00
R1612:Map4k2 UTSW 19 6343341 missense probably damaging 1.00
R2069:Map4k2 UTSW 19 6342738 unclassified probably benign
R2370:Map4k2 UTSW 19 6341928 nonsense probably null
R3080:Map4k2 UTSW 19 6353188 missense probably damaging 0.99
R3896:Map4k2 UTSW 19 6341928 nonsense probably null
R4088:Map4k2 UTSW 19 6353156 missense probably damaging 0.99
R4817:Map4k2 UTSW 19 6344429 missense probably damaging 0.97
R4888:Map4k2 UTSW 19 6344003 missense probably benign 0.07
R5226:Map4k2 UTSW 19 6346504 unclassified probably benign
R5544:Map4k2 UTSW 19 6345914 critical splice acceptor site probably null
R5687:Map4k2 UTSW 19 6345642 unclassified probably benign
R5688:Map4k2 UTSW 19 6346806 missense probably damaging 1.00
R5726:Map4k2 UTSW 19 6351332 missense probably damaging 0.99
R5750:Map4k2 UTSW 19 6351337 missense probably benign 0.15
R5908:Map4k2 UTSW 19 6351316 splice site probably benign
R6402:Map4k2 UTSW 19 6344081 critical splice donor site probably null
R6843:Map4k2 UTSW 19 6353447 missense probably damaging 0.98
R6942:Map4k2 UTSW 19 6346709 missense possibly damaging 0.95
R7227:Map4k2 UTSW 19 6346594 missense probably damaging 1.00
R7573:Map4k2 UTSW 19 6344064 missense probably benign
R7632:Map4k2 UTSW 19 6344054 missense probably benign
R7893:Map4k2 UTSW 19 6353511 missense probably damaging 0.98
R8257:Map4k2 UTSW 19 6346000 missense probably benign 0.00
X0010:Map4k2 UTSW 19 6353318 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGCTGGCCCTAACCAAG -3'
(R):5'- AAGGAGGACTGCTTAGTCACAG -3'

Sequencing Primer
(F):5'- TACAGCAGAGAGGCTTCTGC -3'
(R):5'- AGGACTGCTTAGTCACAGTCATG -3'
Posted On2015-04-02