Incidental Mutation 'R3826:Rgs12'
ID275395
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Nameregulator of G-protein signaling 12
Synonyms1200016K18Rik, 4632412M04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34949445-35039644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34966015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 381 (V381M)
Ref Sequence ENSEMBL: ENSMUSP00000084970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030984
AA Change: V381M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: V381M

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087684
AA Change: V381M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: V381M

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128161
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 34975219 missense probably benign 0.25
IGL02296:Rgs12 APN 5 34966120 missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35020353 missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35030517 missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35025883 missense probably damaging 0.97
IGL02989:Rgs12 APN 5 34965119 missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35030080 missense probably benign 0.01
R0611:Rgs12 UTSW 5 35019460 missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35023122 missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35024366 unclassified probably benign
R1174:Rgs12 UTSW 5 34966465 missense probably benign 0.00
R1538:Rgs12 UTSW 5 35021167 missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35039282 missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 34966403 missense probably benign 0.34
R1791:Rgs12 UTSW 5 34966112 missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 34965674 missense probably damaging 1.00
R1872:Rgs12 UTSW 5 34965821 missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35032269 missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35030528 missense probably benign 0.00
R2107:Rgs12 UTSW 5 34966735 missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35032354 missense probably damaging 1.00
R3827:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35032311 missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35020356 missense probably damaging 1.00
R5132:Rgs12 UTSW 5 34989812 intron probably benign
R5213:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35021104 unclassified probably benign
R5480:Rgs12 UTSW 5 34966111 missense probably benign 0.09
R5510:Rgs12 UTSW 5 34966039 missense probably damaging 1.00
R5708:Rgs12 UTSW 5 34966352 missense probably benign 0.41
R5987:Rgs12 UTSW 5 35020345 missense probably damaging 1.00
R6053:Rgs12 UTSW 5 34965952 missense probably benign 0.01
R6113:Rgs12 UTSW 5 35020323 missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35020332 missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35023092 missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35023171 missense probably null 0.27
R6857:Rgs12 UTSW 5 35030022 nonsense probably null
R7082:Rgs12 UTSW 5 34966706 missense probably benign 0.00
R7250:Rgs12 UTSW 5 34965497 missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35026371 missense probably benign 0.06
R7444:Rgs12 UTSW 5 35025943 missense possibly damaging 0.65
R7632:Rgs12 UTSW 5 34965590 missense probably damaging 1.00
R8049:Rgs12 UTSW 5 35026030 missense possibly damaging 0.89
R8089:Rgs12 UTSW 5 35020348 missense probably damaging 1.00
R8241:Rgs12 UTSW 5 34965773 missense probably damaging 1.00
Z1176:Rgs12 UTSW 5 34965769 missense probably damaging 1.00
Z1177:Rgs12 UTSW 5 34964854 start gained probably benign
Z1177:Rgs12 UTSW 5 35026352 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CGAGAAGCTGGCATTCAGTG -3'
(R):5'- ACTACAAGCACCCTGTTGCTC -3'

Sequencing Primer
(F):5'- ATTCAGTGCAGTGTGCCC -3'
(R):5'- GCTCTTCTCTTCCTGGTTGAAATTG -3'
Posted On2015-04-02