Incidental Mutation 'R3826:Hgfac'
ID275396
Institutional Source Beutler Lab
Gene Symbol Hgfac
Ensembl Gene ENSMUSG00000029102
Gene Namehepatocyte growth factor activator
SynonymsHGFA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location35041509-35048461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35048162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 595 (D595E)
Ref Sequence ENSEMBL: ENSMUSP00000030985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000202573]
Predicted Effect probably damaging
Transcript: ENSMUST00000030985
AA Change: D595E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102
AA Change: D595E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202168
Predicted Effect probably benign
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202921
Meta Mutation Damage Score 0.5483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that proteolytically activates hepatocyte growth factor (HGF) and plays a vital role in the regulation of HGF activity in the regeneration and repair of various tissues. The encoded protein is an inactive zymogen that is proteolytically activated to generate a heterodimeric enzyme consisting of a short chain and a long chain linked by a disulfide bridge. Mice lacking the encoded protein display an impairment in mucosal regeneration after injury. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display impaired intestinal regeneration and increased mortality after intestinal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Hgfac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hgfac APN 5 35046526 missense probably damaging 1.00
IGL01999:Hgfac APN 5 35044811 missense probably benign
IGL02133:Hgfac APN 5 35046587 missense probably damaging 1.00
IGL02314:Hgfac APN 5 35041597 start codon destroyed probably benign 0.21
IGL02337:Hgfac APN 5 35042378 missense probably benign 0.00
IGL02405:Hgfac APN 5 35044480 missense probably benign 0.19
IGL02451:Hgfac APN 5 35043814 splice site probably null
IGL02508:Hgfac APN 5 35047220 missense probably damaging 1.00
IGL02584:Hgfac APN 5 35043961 unclassified probably benign
IGL02986:Hgfac APN 5 35043863 missense probably benign 0.00
R0506:Hgfac UTSW 5 35044240 missense probably damaging 1.00
R0664:Hgfac UTSW 5 35048178 missense probably benign 0.34
R1733:Hgfac UTSW 5 35043674 missense probably damaging 1.00
R1775:Hgfac UTSW 5 35042850 unclassified probably benign
R1871:Hgfac UTSW 5 35042913 makesense probably null
R4553:Hgfac UTSW 5 35042856 missense probably damaging 0.97
R5888:Hgfac UTSW 5 35045407 missense probably damaging 1.00
R5905:Hgfac UTSW 5 35042362 missense probably benign 0.20
R6017:Hgfac UTSW 5 35044395 missense probably damaging 1.00
R6056:Hgfac UTSW 5 35041629 nonsense probably null
R6124:Hgfac UTSW 5 35044384 missense probably benign 0.06
R7059:Hgfac UTSW 5 35044429 missense possibly damaging 0.49
R7232:Hgfac UTSW 5 35046914 missense probably damaging 1.00
R7555:Hgfac UTSW 5 35042628 missense probably damaging 0.96
R8367:Hgfac UTSW 5 35045446 missense probably damaging 1.00
R8371:Hgfac UTSW 5 35045443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGGCCACACTTCTCAG -3'
(R):5'- GGTACTATGAGCATCCCTTCCTTG -3'

Sequencing Primer
(F):5'- TTCTCAGAAAAACCTGTCATCTGC -3'
(R):5'- GGGTTCAGGACGTAGCCAC -3'
Posted On2015-04-02