Incidental Mutation 'R3826:Ube3b'
ID 275398
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3826 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114538012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 368 (Q368K)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably damaging
Transcript: ENSMUST00000074002
AA Change: Q368K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: Q368K

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183408
Predicted Effect unknown
Transcript: ENSMUST00000196651
AA Change: Q87K
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577
AA Change: Q87K

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.0990 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm1 T A 3: 59,843,896 (GRCm39) S197T possibly damaging Het
Actl6b T C 5: 137,565,535 (GRCm39) L377P probably damaging Het
Apc C A 18: 34,412,388 (GRCm39) Q236K possibly damaging Het
Atn1 G A 6: 124,723,182 (GRCm39) probably benign Het
Ccr3 A G 9: 123,829,714 (GRCm39) T350A possibly damaging Het
Cdc42bpg T C 19: 6,367,675 (GRCm39) V1015A probably damaging Het
Chd2 A G 7: 73,141,163 (GRCm39) Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 (GRCm39) probably benign Het
Col4a1 C A 8: 11,259,650 (GRCm39) G1341V probably damaging Het
Commd9 C A 2: 101,727,486 (GRCm39) N93K probably benign Het
Cplane2 C T 4: 140,945,900 (GRCm39) R148C probably damaging Het
Cx3cl1 A T 8: 95,503,934 (GRCm39) probably benign Het
Dhx37 T C 5: 125,508,677 (GRCm39) K86R probably benign Het
Dlec1 T C 9: 118,972,129 (GRCm39) probably benign Het
Dnah17 G A 11: 117,931,984 (GRCm39) probably benign Het
Fam234a T C 17: 26,437,163 (GRCm39) E172G probably benign Het
Ffar2 A T 7: 30,519,510 (GRCm39) I10N possibly damaging Het
Gas2 T C 7: 51,586,367 (GRCm39) probably null Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Grpel1 T A 5: 36,626,827 (GRCm39) N36K probably benign Het
Hgfac C A 5: 35,205,506 (GRCm39) D595E probably damaging Het
Kcnj10 A T 1: 172,197,616 (GRCm39) S377C probably damaging Het
Kcnq2 C T 2: 180,746,693 (GRCm39) V369I possibly damaging Het
Kcnt1 T C 2: 25,805,880 (GRCm39) probably null Het
Lpcat1 T C 13: 73,637,212 (GRCm39) I114T possibly damaging Het
Mast4 G T 13: 102,875,319 (GRCm39) H1350N probably damaging Het
Mcts1 T C X: 37,691,445 (GRCm39) probably benign Het
Muc21 A G 17: 35,932,504 (GRCm39) probably benign Het
Myg1 G C 15: 102,246,171 (GRCm39) G349R probably damaging Het
Ncor2 T C 5: 125,195,756 (GRCm39) probably benign Het
Or1o4 T A 17: 37,591,140 (GRCm39) Y57F probably damaging Het
Or5t17 T A 2: 86,832,388 (GRCm39) I25K probably damaging Het
Or9g4b C T 2: 85,616,559 (GRCm39) R235* probably null Het
Panx2 A G 15: 88,952,664 (GRCm39) D377G probably damaging Het
Pcdhb10 C A 18: 37,545,470 (GRCm39) T182N probably damaging Het
Pdha2 G T 3: 140,916,889 (GRCm39) F206L possibly damaging Het
Pgd T C 4: 149,250,461 (GRCm39) probably benign Het
Pgs1 C T 11: 117,910,584 (GRCm39) probably null Het
Rere T C 4: 150,554,785 (GRCm39) V161A probably benign Het
Rgs12 G A 5: 35,123,359 (GRCm39) V381M possibly damaging Het
Rrm2 G T 12: 24,758,598 (GRCm39) A47S probably benign Het
Rsph6a T C 7: 18,791,539 (GRCm39) L236P probably damaging Het
Rtkn2 A T 10: 67,833,456 (GRCm39) probably null Het
Rubcnl C T 14: 75,269,665 (GRCm39) L108F possibly damaging Het
Sap18b T C 8: 96,552,185 (GRCm39) F65S probably damaging Het
Scap A G 9: 110,210,365 (GRCm39) M925V probably benign Het
Slc7a8 A G 14: 54,975,029 (GRCm39) I200T probably damaging Het
Srrm3 A G 5: 135,886,068 (GRCm39) D336G probably damaging Het
Stk11 T C 10: 79,963,782 (GRCm39) probably null Het
Tiam2 C G 17: 3,557,976 (GRCm39) probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Trio T A 15: 27,833,156 (GRCm39) K75N probably damaging Het
Tspan18 T C 2: 93,050,453 (GRCm39) I57V probably benign Het
Zfhx4 A T 3: 5,466,269 (GRCm39) K2142N probably damaging Het
Zfp37 T C 4: 62,110,800 (GRCm39) N88S probably benign Het
Zswim8 C T 14: 20,761,157 (GRCm39) R142* probably null Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCTCTCCTTGCAGGCAATC -3'
(R):5'- ATGGGCTACTAAATGTTCTCCTGG -3'

Sequencing Primer
(F):5'- AGGCAATCTCCTGCACTTGG -3'
(R):5'- AGGGCATTGGATCCCATTAC -3'
Posted On 2015-04-02